SMPD2-sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) Gene View larger

SMPD2-sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SMPD2-sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SMPD2-sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000038
Product type: DNA & cDNA
Ncbi symbol: SMPD2
Origin species: Human
Product name: SMPD2-sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) Gene
Size: 2ug
Accessions: BC000038
Gene id: 6610
Gene description: sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)
Synonyms: ISC1; NSMASE; NSMASE1; sphingomyelin phosphodiesterase 2; N-SMase; lyso-PAF-PLC; lyso-platelet-activating factor-phospholipase C; neutral sphingomyelinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcccaacttctccctgcgactgcggatcttcaacctcaactgctggggcattccgtacttgagcaagcaccgggccgaccgcatgaggcgcctgggagactttctgaaccaggagagcttcgacctggctttgctggaggaggtgtggagtgagcaggacttccagtacctgagacagaagctgtcacctacctacccagctgcacaccacttccggagcggaatcattggcagtggcctctgtgtcttctccaaacatccaatccaggagcttacccagcacatctacactctcaatggctacccctacatgatccatcatggtgactggttcagtgggaaggctgtggggctgctggtgctccatctaagtggcatggtgctcaacgcctatgtgacccatctccatgccgaatacaatcgacagaaggacatctacctagcacatcgtgtggcccaagcttgggaattggcccagttcatccaccacacatccaagaaggcagacgtggttctgttgtgtggagacctcaacatgcacccagaagacctgggctgctgcctgctgaaggagtggacagggcttcatgatgcctatcttgaaactcgggacttcaagggctctgaggaaggcaacacaatggtacccaagaactgctacgtcagccagcaggagctgaagccatttccctttggtgtccgcattgactacgtgctttacaaggcagtttctgggttttacatctcctgtaagagttttgaaaccactacaggctttgaccctcacagtggcacccccctctctgatcatgaagccctgatggctactctgtttgtgaggcacagccccccacagcagaaccccagctctacccacggaccagcagagaggtcgccgttgatgtgtgtgctaaaggaggcctggacggagctgggtctgggcatggctcaggctcgctggtgggccaccttcgctagctatgtgattggcctggggctgcttctcctggcactgctgtgtgtcctggcggctggaggaggggccggggaagctgccatactgctctggacccccagtgtagggctggtgctgtgggcaggtgcattctacctcttccacgtacaggaggtcaatggcttatatagggcccaggctgagctccagcatgtgctaggaagggcaagggaggcccaggatctgggcccagagcctcagccagccctactcctggggcagcaggagggggacagaactaaagaacaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
- TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
- platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa
- TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa

Buy SMPD2-sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) Gene now

Add to cart