Login to display prices
Login to display prices
TAF9-TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa Gene View larger

TAF9-TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa Gene

PTXBC007349

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TAF9-TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TAF9-TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa Gene

Proteogenix catalog: PTXBC007349
Ncbi symbol: TAF9
Product name: TAF9-TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa Gene
Size: 2ug
Accessions: BC007349
Gene id: 6880
Gene description: TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Synonyms: TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa; MGC:5067; STAF31/32; TAF2G; TAFII-31; TAFII-32; TAFII31; TAFII32; TAFIID32; transcription initiation factor TFIID subunit 9; RNA polymerase II TBP-associated factor subunit G; transcription initiation factor TFIID 31 kD subunit; transcription initiation factor TFIID 31 kDa subunit; transcription initiation factor TFIID 32 kDa subunit; TATA-box binding protein associated factor 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgcttccgaacatcctgctcaccggtacaccaggggttggaaaaaccacactaggcaaagaacttgcgtcaaaatcaggactgaaatacattaatgtgggtgatttagctcgagaagagcaattgtatgatggctatgatgaagagtatgactgtcccattttagatgaagacagagtagttgatgagttagataaccaaatgagagaaggtggagttattgttgattaccatggttgtgatttcttccctgaacgctggtttcatatagtttttgtgctgagaacagataccaatgtattgtacgaaagacttgaaacaaggggttataatgagaagaaactaacagacaatattcagtgtgagatttttcaagttctttatgaagaagccacagcatcctacaaggaagaaatcgtgcatcagctgcccagtaataaaccagaagagctagaaaataatgtagatcagatcttgaaatggattgagcagtggatcaaagatcataactcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice