Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TAF9-TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa Gene
PTXBC007349
New product
Data sheet of TAF9-TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TAF9-TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007349 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TAF9 |
| Origin species: | Human |
| Product name: | TAF9-TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa Gene |
| Size: | 2ug |
| Accessions: | BC007349 |
| Gene id: | 6880 |
| Gene description: | TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa |
| Synonyms: | TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa; MGC:5067; STAF31/32; TAF2G; TAFII-31; TAFII-32; TAFII31; TAFII32; TAFIID32; transcription initiation factor TFIID subunit 9; RNA polymerase II TBP-associated factor subunit G; transcription initiation factor TFIID 31 kD subunit; transcription initiation factor TFIID 31 kDa subunit; transcription initiation factor TFIID 32 kDa subunit; TATA-box binding protein associated factor 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgcttccgaacatcctgctcaccggtacaccaggggttggaaaaaccacactaggcaaagaacttgcgtcaaaatcaggactgaaatacattaatgtgggtgatttagctcgagaagagcaattgtatgatggctatgatgaagagtatgactgtcccattttagatgaagacagagtagttgatgagttagataaccaaatgagagaaggtggagttattgttgattaccatggttgtgatttcttccctgaacgctggtttcatatagtttttgtgctgagaacagataccaatgtattgtacgaaagacttgaaacaaggggttataatgagaagaaactaacagacaatattcagtgtgagatttttcaagttctttatgaagaagccacagcatcctacaaggaagaaatcgtgcatcagctgcccagtaataaaccagaagagctagaaaataatgtagatcagatcttgaaatggattgagcagtggatcaaagatcataactcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa - TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa - TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa - transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) |