Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PAFAH1B3-platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa Gene
PTXBC003016
New product
Data sheet of PAFAH1B3-platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PAFAH1B3-platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003016 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PAFAH1B3 |
| Origin species: | Human |
| Product name: | PAFAH1B3-platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa Gene |
| Size: | 2ug |
| Accessions: | BC003016 |
| Gene id: | 5050 |
| Gene description: | platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa |
| Synonyms: | PAFAHG; platelet-activating factor acetylhydrolase IB subunit gamma; PAF acetylhydrolase 29 kDa subunit; PAF-AH 29 kDa subunit; PAF-AH subunit gamma; PAF-AH1b alpha 1 subunit; PAFAH subunit gamma; platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa); platelet-activating factor acetylhydrolase, isoform Ib, subunit 3 (29kDa); platelet activating factor acetylhydrolase 1b catalytic subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtggagaggagaacccagccagcaagcccacgccggtgcaggacgtacagggcgacgggcgctggatgtccctgcaccatcggttcgtggctgacagcaaagataaggaacccgaagtcgtcttcatcggggactccttggtccagctcatgcaccagtgcgagatctggcgcgagctcttctctcctctgcatgcacttaactttggcattggtggtgacggcacacagcatgtactgtggcggctggagaatggggagctggaacacatccggcccaagattgtggtggtctgggtgggcaccaacaaccacggacacacagcagagcaggtgactggtggcatcaaggccattgtgcaactggtgaatgagcgacagccccaggcccgggttgtggtgctgggcctgcttccgcgaggccaacatcccaacccacttcgggagaagaaccgacaggtgaacgagctggtacgggcggcactggctggccaccctcgggcccacttcctagatgccgaccctggctttgtgcactcagatggcaccatcagccatcatgacatgtatgattacctgcatctgagccgcctgggctacacacctgtttgccgggctctgcactccctgcttctgcgtctgctggcccaagaccagggccaaggtgctcccctgctggagcccgcaccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa - TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa - transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11) |