Login to display prices
Login to display prices
CXCL1-chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) Gene View larger

CXCL1-chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) Gene

PTXBC011976

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCL1-chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CXCL1-chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) Gene

Proteogenix catalog: PTXBC011976
Ncbi symbol: CXCL1
Product name: CXCL1-chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) Gene
Size: 2ug
Accessions: BC011976
Gene id: 2919
Gene description: chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
Synonyms: FSP; GRO1; GROa; MGSA; MGSA-a; NAP-3; SCYB1; growth-regulated alpha protein; C-X-C motif chemokine 1; GRO-alpha(1-73); GRO1 oncogene (melanoma growth stimulating activity, alpha); GRO1 oncogene (melanoma growth-stimulating activity); MGSA alpha; chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha); fibroblast secretory protein; melanoma growth stimulating activity, alpha; melanoma growth stimulatory activity alpha; neutrophil-activating protein 3; C-X-C motif chemokine ligand 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaagtgtgaacgtgaagtcccccggaccccactgcgcccaaaccgaagtcatagccacactcaagaatgggcggaaagcttgcctcaatcctgcatcccccatagttaagaaaatcatcgaaaagatgctgaacagtgacaaatccaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: