Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CXCL1-chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) Gene
PTXBC011976
New product
Data sheet of CXCL1-chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CXCL1-chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011976 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CXCL1 |
| Origin species: | Human |
| Product name: | CXCL1-chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) Gene |
| Size: | 2ug |
| Accessions: | BC011976 |
| Gene id: | 2919 |
| Gene description: | chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) |
| Synonyms: | FSP; GRO1; GROa; MGSA; MGSA-a; NAP-3; SCYB1; growth-regulated alpha protein; C-X-C motif chemokine 1; GRO-alpha(1-73); GRO1 oncogene (melanoma growth stimulating activity, alpha); GRO1 oncogene (melanoma growth-stimulating activity); MGSA alpha; chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha); fibroblast secretory protein; melanoma growth stimulating activity, alpha; melanoma growth stimulatory activity alpha; neutrophil-activating protein 3; C-X-C motif chemokine ligand 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaagtgtgaacgtgaagtcccccggaccccactgcgcccaaaccgaagtcatagccacactcaagaatgggcggaaagcttgcctcaatcctgcatcccccatagttaagaaaatcatcgaaaagatgctgaacagtgacaaatccaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) - TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa - sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) - DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) |