TAF8-TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa Gene View larger

TAF8-TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TAF8-TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TAF8-TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033728
Product type: DNA & cDNA
Ncbi symbol: TAF8
Origin species: Human
Product name: TAF8-TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa Gene
Size: 2ug
Accessions: BC033728
Gene id: 129685
Gene description: TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
Synonyms: TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa; TAF; TAFII-43; TAFII43; TBN; transcription initiation factor TFIID subunit 8; TAF(II)43; TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 45/50kDa; TBP-associated factor 43 kDa; TBP-associated factor 8; TBP-associated factor TAFII43; TBP-associated factor, RNA polymerase II, 43 kD; hTAFII43; protein taube nuss; taube nuss homolog; transcription initiation factor TFIID 43 kDa subunit; TATA-box binding protein associated factor 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgacgcggcggccacagctggggccggtggctccggaacgagatcgggaagtaaacagtccactaaccctgccgataactatcatctggcccggaggagaaccctgcaggtggttgtgagctccttgctgacagaggcagggtttgagagtgccgagaaagcatccgtggaaacgctgacagagatgctgcagagctacatttcagaaattgggagaagtgccaagtcttactgtgagcacacagccaggacccagcccacactgtccgatatcgtggtcacacttgttgagatgggtttcaatgtggacactctccctgcttatgcaaaacggtctcagaggatggtcatcactgctcctccggtgaccaatcagccagtgacccccaaggccctcactgcagggcagaaccgaccccacccgccgcacatccccagccattttcctgagttccctgatccccacacctacatcaaaactccggtgagtgatgaagcactgggactgcgcgtggtgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)
- DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
- TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
- platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa

Buy TAF8-TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa Gene now

Add to cart