Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DCUN1D5-DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) Gene
PTXBC004169
New product
Data sheet of DCUN1D5-DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DCUN1D5-DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004169 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DCUN1D5 |
| Origin species: | Human |
| Product name: | DCUN1D5-DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC004169 |
| Gene id: | 84259 |
| Gene description: | DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) |
| Synonyms: | SCCRO5; DCN1-like protein 5; DCN1, defective in cullin neddylation 1, domain containing 5; DCUN1 domain-containing protein 5; defective in cullin neddylation protein 1-like protein 5; defective in cullin neddylation 1 domain containing 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggtgaagaagaagagaaaatcccctggggtggcagcagcagtagcggaagacggaggcctcaaaaagtgtaaaatctccagctattgcagatcccaaccccctgctagactaataagtggagaggaacatttttcaagcaagaagtgcctggcttggttttatgaatatgcaggtcctgatgaagttgtagggccagaaggaatggaaaaattttgtgaagacattggtgttgaacctgaaaatattattatgttagttttagcgtggaaattggaggctgaaagcatgggattttttaccaaggaagaatggttaaagggaatgacttcattacagtgtgactgcacagaaaagttacaaaacaaatttgactttttgcgctcacagttgaatgatatttcgtcatttaagaatatctacagatatgcctttgattttgcaagggataaagatcagagaagccttgatattgatactgctaaatctatgttagctcttctgcttgggaggacatggccactgttttcagtattttaccagtacctggagcaatcaaagtatcgtgttatgaacaaagatcaatggtacaatgtattagaattcagcagaacagtccatgctgatcttagtaactatgatgaagatggtgcttggcctgttcttcttgatgaatttgttgagtggcaaaaagtccgtcagacatcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa - sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) - DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) - TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa |