Login to display prices
Login to display prices
SLC7A6-solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene View larger

SLC7A6-solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene

PTXBC028216

New product

Data sheet of SLC7A6-solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC7A6-solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC028216
Ncbi symbol: SLC7A6
Product name: SLC7A6-solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene
Size: 2ug
Accessions: BC028216
Gene id: 9057
Gene description: solute carrier family 7 (cationic amino acid transporter, y+ system), member 6
Synonyms: LAT-2; LAT3; y+LAT-2; Y+L amino acid transporter 2; amino acid permease; cationic amino acid transporter, y+ system; solute carrier family 7 (amino acid transporter light chain, y+L system), member 6; solute carrier family 7 (cationic amino acid transporter, y+ system), member 6; y(+)L-type amino acid transporter 2; y+LAT2; solute carrier family 7 member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagccagggagcctgggaggcccacacccacctaccatcttgtccctaacaccagccagtcccaggtggaagaagatgtcagctcgccacctcaaaggtcctccgaaactatgcagctgaagaaggagatctccctgctgaatggggtcagcctggtggtgggcaacatgatcggctcagggatctttgtctcacccaagggtgtgctggtacacactgcctcctatgggatgtcactgattgtgtgggccattggtgggctcttctctgttgtgggtgccctttgttatgcagagctggggaccaccatcaccaagtcgggagccagctacgcttatattctagaggcctttgggggcttcattgccttcatccgcctgtgggtctcactgctagttgttgagcccaccggtcaggccatcatcgccatcacctttgccaactacatcatccagccgtccttccccagctgtgatcccccatacctggcctgccgtctcctggctgctgcttgcatatgtctgctgacatttgtgaactgtgcctatgtcaagtggggcacacgtgtgcaggacacgttcacttacgccaaggtcgtagcgctcattgccatcattgtcatgggccttgttaaactgtgccagggacactctgagcactttcaggacgcctttgagggttcctcctgggacatgggaaacctctctcttgccctctactctgccctcttctcttactcaggttgggacacccttaattttgtaacagaagaaatcaaaaacccagaaagaaatttgcccttggccattgggatttctatgccaattgtgacgctcatctacatcctgaccaatgtggcctattacacagtgctgaacatttcagatgtccttagcagtgatgctgtggctgtgacatttgctgaccagacgtttggcatgttcagctggaccatccccattgctgttgccctgtcctgctttgggggcctcaatgcatccatctttgcttcatcaaggttgttcttcgtgggctcccgggagggccacctaccggaccttctgtccatgatccacattgagcgttttacacctatccctgctttactgttcaattgcaccatggcactcatctacctcatcgtggaggatgttttccagcttatcaactacttcagcttcagctactggttcttcgtgggcctgtctgttgttggacagctctacctccgctggaaggagcccaagcggccccggcctctcaagctgagcgtgtttttccccatcgtgttctgcatatgctccgtgtttctggtgatagtgcccctcttcactgacaccattaattccctcattggcatcgggattgccctttctggagtccctttctacttcatgggtgtttacctgccagagtcccggaggccattgtttattcggaatgtcctggctgctatcaccagaggcacccagcagctttgcttttgtgtcctgactgagcttgatgtagccgaagaaaaaaaggatgagaggaaaactgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: