Login to display prices
Login to display prices
APOBEC4-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative) Gene View larger

APOBEC4-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APOBEC4-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about APOBEC4-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative) Gene

Proteogenix catalog: PTXBC021711
Ncbi symbol: APOBEC4
Product name: APOBEC4-apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative) Gene
Size: 2ug
Accessions: BC021711
Gene id: 403314
Gene description: apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
Synonyms: C1orf169; apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative); apolipoprotein B mRNA editing enzyme catalytic polypeptide like 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcccatatatgaggagtacctagcaaatcatggaacaatagtaaaaccatattactggctaagcttctctctcgattgctctaattgtccttaccatattcgaacaggtgaagaagcaagagtttccctcacagaattttgtcagatttttggattcccttatgggacaacatttcctcaaacaaaacacctcacattttatgaactaaaaacttcttctggtagcctggtgcaaaagggccatgctagcagttgcactgggaattatatccatccagaatcaatgctctttgaaatgaatggttatcttgactcagccatatacaataatgacagcatcaggcatatcattctgtattccaacaactccccttgtaatgaagctaaccactgctgcatcagcaaaatgtataatttcctgattacgtatccaggcatcactcttagtatttatttttctcagctctatcatactgagatggactttcctgcctcagcatggaaccgcgaagctctccggagcctggccagcttatggccgcgggttgttttgagtccaataagtggtgggatctggcattctgttctccacagctttataagtggtgtctcaggatcacatgtttttcagcccattttaactgggagagcactggctgacaggcacaacgcatatgaaatcaatgccataacaggcgtaaaaccttacttcactgatgttcttctccagacaaaaaggaatccaaacacaaaagctcaggaggctttagagagctaccccttaaacaatgcctttcctggacagttttttcaaatgccgagtggacaactccaacccaacctacctccagacctcagggctcctgttgtttttgtgctagtgcctctcagggacttaccaccaatgcatatgggccaaaacccaaataaacccaggaatatcgtaaggcacttaaatatgcctcaaatgtcattccaggaaaccaaggaccttggaaggcttcccactggaaggtcagtggagatagtggaaatcacagaacagtttgcaagtagcaaggaggcagatgaaaagaagaagaagaaagggaagaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: