Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ELOVL1-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 Gene
PTXBC000618
New product
Data sheet of ELOVL1-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ELOVL1-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000618 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELOVL1 |
| Origin species: | Human |
| Product name: | ELOVL1-elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC000618 |
| Gene id: | 64834 |
| Gene description: | elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 |
| Synonyms: | 3-keto acyl-CoA synthase ELOVL1; CGI-88; Ssc1; elongation of very long chain fatty acids protein 1; ELOVL FA elongase 1; elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1; very long chain 3-ketoacyl-CoA synthase 1; very long chain 3-oxoacyl-CoA synthase 1; ELOVL fatty acid elongase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggctgttgtgaacttgtaccaagaggtgatgaagcacgcagatccccggatccagggctaccctctgatggggtcccccttgctaatgacctccattctcctgacctacgtgtacttcgttctctcacttgggcctcgcatcatggctaatcggaagcccttccagctccgtggcttcatgattgtctacaacttctcactggtggcactctccctctacattgtctatgagttcctgatgtcgggctggctgagcacctatacctggcgctgtgaccctgtggactattccaacagccctgaggcacttaggatggttcgggtggcctggctcttcctcttctccaagttcattgagctgatggacacagtgatctttattctccgaaagaaagacgggcaggtgaccttcctacatgtcttccatcactctgtgcttccctggagctggtggtggggggtaaagattgccccgggaggaatgggctctttccatgccatgataaactcttccgtgcatgtcataatgtacctgtactacggattatctgcctttggccctgtggcacaaccctacctttggtggaaaaagcacatgacagccattcagctgatccagtttgtcctggtctcactgcacatctcccagtactactttatgtccagctgtaactaccagtacccagtcattattcacctcatctggatgtatggcaccatcttcttcatgctgttctccaacttctggtatcactcttataccaagggcaagcggctgccccgtgcacttcagcaaaatggagctccaggtattgccaaggtcaaggccaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) - sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) - elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 - elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 |