LILRA2-leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 Gene View larger

LILRA2-leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 Gene

PTXBC017412

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LILRA2-leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LILRA2-leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017412
Product type: DNA & cDNA
Ncbi symbol: LILRA2
Origin species: Human
Product name: LILRA2-leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 Gene
Size: 2ug
Accessions: BC017412
Gene id: 11027
Gene description: leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2
Synonyms: CD85H; ILT1; LIR-7; LIR7; leukocyte immunoglobulin-like receptor subfamily A member 2; CD85 antigen-like family member H; immunoglobulin-like transcript 1; leucocyte Ig-like receptor A2; leukocyte immunoglobulin-like receptor 7; leukocyte immunoglobulin-like receptor subfamily A member 2 soluble; leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2; leukocyte immunoglobulin like receptor A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccccatcctcacggtcctgatctgtctcgggctgagtctgggccccaggacccacgtgcaggcagggcacctccccaagcccaccctctgggctgagccaggctctgtgatcatccagggaagtcctgtgaccctcaggtgtcaggggagccttcaggctgaggagtaccatctatatagggaaaacaaatcagcatcctgggttagacggatacaagagcctgggaagaatggccagttccccatcccatccatcacctgggaacacgcagggcggtatcactgtcagtactacagccacaatcactcatcagagtacagtgaccccctggagctggtggtgacaggagcctacagcaaacccaccctctcagctctgcccagccctgtggtgaccttaggagggaacgtgaccctccagtgtgtctcacaggtggcatttgacggcttcattctgtgtaaggaaggagaagatgaacacccacaacgcctgaactcccattcccatgcccgtgggtggtcctgggccatcttctccgtgggccccgtgagcccgagtcgcaggtggtcgtacaggtgctatgcttatgactcgaactctccctatgtgtggtctctacccagtgatctcctggagctcctggtcccaggtgtttctaagaagccatcactctcagtgcagccaggtcctatggtggcccctggggagagcctgaccctccagtgtgtctctgatgtcggctacgacagatttgttctgtataaggagggagaacgtgacttcctccagcgccctggttggcagccccaggctgggctctcccaggccaacttcaccctgggccctgtgagcccctcccacgggggccagtacagatgctacagtgcacacaacctctcctccgagtggtcggcccccagtgaccccctggacatcctgatcacaggacagttctatgacagaccctctctctcggtgcagccggtccccacagtagccccaggaaagaacgtgaccctgctgtgtcagtcacgggggcagttccacactttccttctgaccaaggagggggcaggccatcccccactgcatctgagatcagagcaccaagctcagcagaaccaggctgaattccgcatgggtcctgtgacctcagcccacgtggggacctacagatgctacagctcactcagctccaacccctacctgctgtctctccccagtgaccccctggagctcgtggtctcagcatccctaggccaacacccccaggattacacagtggagaatctcatccgcatgggtgtggctggcttggtcctggtggtcctcgggattctgctatttgaggctcagcacagccagagaagcctacaagatgcagccgggaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pleckstrin homology domain containing, family G (with RhoGef domain) member 2
- v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian)
- solute carrier family 22 (organic cation transporter), member 18 antisense
- elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1

Buy LILRA2-leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 Gene now

Add to cart