DLST-dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) Gene View larger

DLST-dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DLST-dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DLST-dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000302
Product type: DNA & cDNA
Ncbi symbol: DLST
Origin species: Human
Product name: DLST-dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) Gene
Size: 2ug
Accessions: BC000302
Gene id: 1743
Gene description: dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Synonyms: DLTS; dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex, mitochondrial; Dihydrolipoyllysine-residue succinyltransferase; E2K; OGDC-E2; dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex); dihydrolipoamide S-succinyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgtcccgatcccgctgtgtgtctcgggcgttcagccgctcgctctccgccttccagaaggggaactgccctctagggagacgttccctgcctggggtctccttatgccagggaccaggttaccctaacagcaggaaggttgtcattaacaacagtgtcttcagtgttcgctttttcagaactacagctgtatgcaaggatgacttggttacagtcaaaaccccagcgtttgcagaatctgtcacagagggagatgtcaggtgggagaaagctgttggagacacagttgcagaagatgaagtggtttgtgagattgaaactgacaagacatctgtgcaggttccatcaccagcaaatggcgtgattgaagctcttttggtacctgatgggggaaaagtcgaaggaggcactccacttttcacactcaggaaaactggtgctgctcctgctaaggccaagccggctgaagctcctgctgctgcagccccaaaagcagaacctacagcagcggcagttcctccccctgcagcacccatacccactcagatgccaccggtgccctcgccctcacaacctccttctggcaaacctgtgtctgcagtaaaacccactgttgccccaccactagctgagccaggagctggcaaaggtctgcgttcagaacatcgggagaaaatgaacaggatgcggcagcgcattgctcagcgtctgaaggaggcccagaatacatgtgcaatgctgacaacttttaatgagattgacatgagtaacatccaggagatgagggctcggcacaaagaggcttttttgaagaaacataacctcaaactaggcttcatgtcggcatttgtgaaggcctcagcctttgccttgcaggaacagcctgttgtaaatgcagtgattgacgacacaaccaaagaggtggtgtatagggattatattgacatcagtgttgcagtggccaccccacggggtctggtggttccagtcatcaggaatgtggaagctatgaattttgcagatattgaacggaccatcactgaactgggagagaaggcccgaaagaatgaacttgccattgaagatatggatggcggtaccttcaccattagcaatggaggcgtttttggctcgctctttggaacacccattatcaacccccctcagtctgccatcctggggatgcatggcatctttgacaggccagtggctataggaggcaaggtagaggtgcggcccatgatgtacgtggcactgacctatgatcaccggctgattgatggcagagaggctgtgactttcctccgcaaaatcaaggcagcggtagaggatcccagagtcctcctcctggatctttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2
- pleckstrin homology domain containing, family G (with RhoGef domain) member 2
- v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian)
- solute carrier family 22 (organic cation transporter), member 18 antisense

Buy DLST-dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) Gene now

Add to cart