Login to display prices
Login to display prices
SIRT6-sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) Gene View larger

SIRT6-sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) Gene

PTXBC005026

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SIRT6-sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SIRT6-sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) Gene

Proteogenix catalog: PTXBC005026
Ncbi symbol: SIRT6
Product name: SIRT6-sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC005026
Gene id: 51548
Gene description: sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)
Synonyms: SIR2L6; NAD-dependent protein deacetylase sirtuin-6; SIR2-like protein 6; regulatory protein SIR2 homolog 6; sir2-related protein type 6; sirtuin type 6; sirtuin 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggtgaattacgcggcggggctgtcgccgtacgcggacaagggcaagtgcggcctcccggagatcttcgaccccccggaggagctggagcggaaggtgtgggaactggcgaggctggtctggcagtcttccagtgtggtgttccacacgggtgccggcatcagcactgcctctggcatccccgacttcaggggtccccacggagtctggaccatggaggagcgaggtctggcccccaagttcgacaccacctttgagagcgcgcggcccacgcagacccacatggcgctggtgcagctggagcgcgtgggcctcctccgcttcctggtcagccagaacgtggacgggctccatgtgcgctcaggcttccccagggacaaactggcagagctccacgggaacatgtttgtggaagaatgtgccaagtgtaagacgcagtacgtccgagacacagtcgtgggcaccatgggcctgaaggccacgggccggctctgcaccgtggctaaggcaagggggctgcgagcctgcaggggagagctgagggacaccatcctagactgggaggactccctgcccgaccgggacctggcactcgccgatgaggccagcaggaacgccgacctgtccatcacgctgggtacatcgctgcagatccggcccagcgggaacctgccgctggctaccaagcgccggggaggccgcctggtcatcgtcaacctgcagcccaccaagcacgaccgccatgctgacctccgcatccatggctacgttgacgaggtcatgacccggctcatgaagcacctggggctggagatccccgcctgggacggcccccgtgtgctggagagggcgctgccacccctgccccgcccgcccacccccaagctggagcccaaggaggaatctcccacccggatcaacggctctatccccgccggccccaagcaggagccctgcgcccagcacaacggctcagagcccgccagccccaaacgggagcggcccaccagccctgccccccacagaccccccaaaagggtgaaggccaaggcggtccccagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: