SLC25A39-solute carrier family 25, member 39 Gene View larger

SLC25A39-solute carrier family 25, member 39 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A39-solute carrier family 25, member 39 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A39-solute carrier family 25, member 39 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009330
Product type: DNA & cDNA
Ncbi symbol: SLC25A39
Origin species: Human
Product name: SLC25A39-solute carrier family 25, member 39 Gene
Size: 2ug
Accessions: BC009330
Gene id: 51629
Gene description: solute carrier family 25, member 39
Synonyms: CGI-69; CGI69; solute carrier family 25 member 39
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaccaggaccctgcgggcatcagccccctccagcaaatggtggcctcaggcaccggggctgtggttacctctctcttcatgacacccctggacgtggtgaaggttcgcctgcagtctcagcggccctccatggccagcgagctgatgccttcctccagactgtggagcctctcctataccaaatggaagtgcctcctgtattgcaatggtgtcctggagcctctgtacctgtgcccaaatggtgcccgctgtgccacctggtttcaagaccctacccgcttcactggcaccatggatgccttcgtgaagatcgtgaggcacgagggcaccaggaccctctggagcggcctccccgccaccctggtgatgactgtgccagctaccgccatctacttcactgcctatgaccaactgaaggccttcctgtgtggtcgagccctgacctctgacctctacgcacccatggtggctggcgcgctggcccgcctgggcaccgtgactgtgatcagccccctggagcttatgcggacaaagctgcaggctcagcatgtgtcgtaccgggagctgggtgcctgtgttcgaactgcagtggctcagggtggctggcgctcactgtggctgggctggggccccactgcccttcgagatgtgcccttctcagccctgtactggttcaactatgagctggtgaagagctggctcaatgggctcaggccgaaggaccagacttctgtgggcatgagctttgtggctggtggcatctcagggacggtggctgcagtgctgactctaccctttgacgtggtaaagacccaacgccaggtcgctctgggagcgatggaggctgtgagagtgaaccccctgcatgtggactccacctggctgctgctgcggaggatccgggccgagtcgggcaccaagggactctttgcaggcttccttcctcggatcatcaaggctgccccctcctgtgccatcatgatcagcacctatgagttcggcaaaagcttcttccagaggctgaaccaggaccggcttctgggcggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pyruvate dehydrogenase (lipoamide) beta
- isocitrate dehydrogenase 3 (NAD+) beta
- chromosome 16 open reading frame 35
- nei endonuclease VIII-like 1 (E. coli)

Buy SLC25A39-solute carrier family 25, member 39 Gene now

Add to cart