Login to display prices
Login to display prices
C16orf35-chromosome 16 open reading frame 35 Gene View larger

C16orf35-chromosome 16 open reading frame 35 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf35-chromosome 16 open reading frame 35 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf35-chromosome 16 open reading frame 35 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004185
Product type: DNA & cDNA
Ncbi symbol: C16orf35
Origin species: Human
Product name: C16orf35-chromosome 16 open reading frame 35 Gene
Size: 2ug
Accessions: BC004185
Gene id: 8131
Gene description: chromosome 16 open reading frame 35
Synonyms: C16orf35; CGTHBA; FFEVF3; HS-40; MARE; NPR3; RMD11; nitrogen permease regulator 3-like protein; -14 gene protein; alpha-globin regulatory element-containing gene protein; conserved gene telomeric to alpha globin cluster; NPR3 like, GATOR1 complex subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgatggaaatgaaggtcctcagtccccattccatcacatcctgcccaagtgcaagctggccagggacctcaaggaagcttatgacagcctgtgcacgtcgggcgtagttcggcttcacatcaacagctggctggaggtgagcttctgcctgccccacaagatccactatgcggcctccagtctgatccccccagaggccatcgaacggagcctgaaagccatccgcccctaccatgccctgctgctgctcagtgatgagaagtccttgctgggtgagcttcctattgactgctcccctgccctagtgcgggtgatcaagaccacatctgctgtgaagaacctgcagcagctagcccaagatgcggacctggccttgctgcaggttttccagcttgcagctcatctggtgtactggggcaaggccatcatcatctacccgctgtgtgagaacaacgtctacatgctgtctcccaatgccagcgtatgtctgtactccccgctggccgagcagttctcccaccagttcccatctcatgacctgccgtccgttcttgccaagttctccttgccggtctccttgtcagaatttaggaatcccctggcccccgctgtgcaggagacccagctcatccagatggtggtgtggatgctgcagcgccggcttctcatccagctgcacacctatgtctgcctgatggcctcacccagcgaggaggagccccgtccgcgagaggacgacgtccccttcactgcccgggtcggcggtcgcagcctcagcacgcccaacgccctcagctttggctccccaaccagcagcgatgacatgaccctcaccagccccagcatggacaactccagcgcagagctacttcccagcggggactcgccactgaaccagaggatgacggagaacctgctggccagcctgtcggagcatgaacgcgcagccatcctcagtgtacccgcagcccagaaccctgaggacctccgcatgtttgccaggctccttcactacttccgcggccgccaccacctggaggagattatgtacaacgagaacacgcggcgctcccagctgctcatgctgtttgacaagttccgcagcgtgctggtggtgaccacccacgaggaccctgtcattgccgtcttccaggctctgctcccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nei endonuclease VIII-like 1 (E. coli)
- chromosome 12 open reading frame 41
- solute carrier family 25, member 46
- serum/glucocorticoid regulated kinase 1