Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NEIL1-nei endonuclease VIII-like 1 (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NEIL1-nei endonuclease VIII-like 1 (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010876 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NEIL1 |
| Origin species: | Human |
| Product name: | NEIL1-nei endonuclease VIII-like 1 (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC010876 |
| Gene id: | 79661 |
| Gene description: | nei endonuclease VIII-like 1 (E. coli) |
| Synonyms: | DNA-(apurinic or apyrimidinic site) lyase Neil1; DNA glycosylase/AP lyase Neil1; FPG1; NEI1; hFPG1; endonuclease 8-like 1; DNA endonuclease eight-like glycosylase 1; NEH1; endonuclease VIII; endonuclease VIII-like 1; nei endonuclease VIII-like 1; nei homolog 1; nei-like protein 1; nei like DNA glycosylase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgagggccccgagctgcacctggccagccagtttgtgaatgaggcctgcagggcgctggtgttcggcggctgcgtggagaagtcctctgtcagccgcaaccctgaggtgccctttgagagcagtgcctaccgcatctcagcttcagcccgcggcaaggagctgcgcctgatactgagccctctgcctggggcccagccccaacaggagccactggccctggtcttccgcttcggcatgtccggctcttttcagctggtgccccgcgaggagctgccacgccatgcccacctgcgcttttacacggccccgcctggcccccggctcgccctatgtttcgtggacatccgccggttcggccgctgggaccttgggggaaagtggcagccgggccgcgggccctgtgtcttgcaggagtaccagcagttcagggagaatgtgctacgaaacctagcggataaggcctttgaccggcccatctgcgaggccctcctggaccagaggttcttcaatggcattggcaactatctgcgggcagagatcctgtaccggctgaagatccccccctttgagaaggcccgctcggtcctggaggccctgcagcagcacaggccgagcccggagctgaccctgagccagaagataaggaccaagctgcagaatccagacctgctggagctatgtcactcagtgcccaaggaagtggtccagttggggggcaggggctacgggtcagagagcggggaggaggactttgctgcctttcgagcctggctgcgctgctatggcatgccaggcatgagctccctgcaggaccggcatggccgtaccatctggttccagggggatcctggaccgttggcacccaaagggcgcaagtcccgcaaaaagaaatccaaggccacacagctgagtcctgaggacagagtggaggacgctttgcctccaagcaaggccccttccaggacacgaagggcaaagagagaccttcctaagaggactgcaacccagcggcctgaggggaccagcctccagcaggacccagaagctcccacagtgcccaagaaggggaggaggaaggggcgacaggcagcctctggccactgcagaccccggaaggtcaaggctgacatcccatccttggaaccagaggggacctcagcctcttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 12 open reading frame 41 - solute carrier family 25, member 46 - serum/glucocorticoid regulated kinase 1 - non-SMC condensin I complex, subunit G |