NEIL1-nei endonuclease VIII-like 1 (E. coli) Gene View larger

NEIL1-nei endonuclease VIII-like 1 (E. coli) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NEIL1-nei endonuclease VIII-like 1 (E. coli) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NEIL1-nei endonuclease VIII-like 1 (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010876
Product type: DNA & cDNA
Ncbi symbol: NEIL1
Origin species: Human
Product name: NEIL1-nei endonuclease VIII-like 1 (E. coli) Gene
Size: 2ug
Accessions: BC010876
Gene id: 79661
Gene description: nei endonuclease VIII-like 1 (E. coli)
Synonyms: DNA-(apurinic or apyrimidinic site) lyase Neil1; DNA glycosylase/AP lyase Neil1; FPG1; NEI1; hFPG1; endonuclease 8-like 1; DNA endonuclease eight-like glycosylase 1; NEH1; endonuclease VIII; endonuclease VIII-like 1; nei endonuclease VIII-like 1; nei homolog 1; nei-like protein 1; nei like DNA glycosylase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgagggccccgagctgcacctggccagccagtttgtgaatgaggcctgcagggcgctggtgttcggcggctgcgtggagaagtcctctgtcagccgcaaccctgaggtgccctttgagagcagtgcctaccgcatctcagcttcagcccgcggcaaggagctgcgcctgatactgagccctctgcctggggcccagccccaacaggagccactggccctggtcttccgcttcggcatgtccggctcttttcagctggtgccccgcgaggagctgccacgccatgcccacctgcgcttttacacggccccgcctggcccccggctcgccctatgtttcgtggacatccgccggttcggccgctgggaccttgggggaaagtggcagccgggccgcgggccctgtgtcttgcaggagtaccagcagttcagggagaatgtgctacgaaacctagcggataaggcctttgaccggcccatctgcgaggccctcctggaccagaggttcttcaatggcattggcaactatctgcgggcagagatcctgtaccggctgaagatccccccctttgagaaggcccgctcggtcctggaggccctgcagcagcacaggccgagcccggagctgaccctgagccagaagataaggaccaagctgcagaatccagacctgctggagctatgtcactcagtgcccaaggaagtggtccagttggggggcaggggctacgggtcagagagcggggaggaggactttgctgcctttcgagcctggctgcgctgctatggcatgccaggcatgagctccctgcaggaccggcatggccgtaccatctggttccagggggatcctggaccgttggcacccaaagggcgcaagtcccgcaaaaagaaatccaaggccacacagctgagtcctgaggacagagtggaggacgctttgcctccaagcaaggccccttccaggacacgaagggcaaagagagaccttcctaagaggactgcaacccagcggcctgaggggaccagcctccagcaggacccagaagctcccacagtgcccaagaaggggaggaggaaggggcgacaggcagcctctggccactgcagaccccggaaggtcaaggctgacatcccatccttggaaccagaggggacctcagcctcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 12 open reading frame 41
- solute carrier family 25, member 46
- serum/glucocorticoid regulated kinase 1
- non-SMC condensin I complex, subunit G

Buy NEIL1-nei endonuclease VIII-like 1 (E. coli) Gene now

Add to cart