PDHB-pyruvate dehydrogenase (lipoamide) beta Gene View larger

PDHB-pyruvate dehydrogenase (lipoamide) beta Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDHB-pyruvate dehydrogenase (lipoamide) beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDHB-pyruvate dehydrogenase (lipoamide) beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000439
Product type: DNA & cDNA
Ncbi symbol: PDHB
Origin species: Human
Product name: PDHB-pyruvate dehydrogenase (lipoamide) beta Gene
Size: 2ug
Accessions: BC000439
Gene id: 5162
Gene description: pyruvate dehydrogenase (lipoamide) beta
Synonyms: PDHBD; PDHE1-B; PHE1B; pyruvate dehydrogenase E1 component subunit beta, mitochondrial; pyruvate dehydrogenase, E1 beta polypeptide; pyruvate dehydrogenase (lipoamide) beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggtgtctggcttggtgcggagaccccttcgggaggtctccgggctgctgaagaggcgctttcactggaccgcgccggctgcgctgcaggtgacagttcgtgatgctataaatcagggtatggatgaggagctggaaagagatgagaaggtatttctgcttggagaagaagttgcccagtatgatggggcatacaaggttagtcgagggctgtggaagaaatatggagacaagaggattattgacactcccatatcagagatgggctttgctggaattgctgtaggtgcagctatggctgggttgcggcccatttgtgaatttatgaccttcaatttctccatgcaagccattgaccaggttataaactcagctgccaagacctactacatgtctggtggccttcagcctgtgcctatagtcttcagggggcccaatggtgcctcagcaggtgtagctgcccagcactcacagtgctttgctgcctggtatgggcactgcccaggcttaaaggtggtcagtccctggaattcagaggatgctaaaggacttattaaatcagccattcgggataacaatccagtggtggtgctagagaatgaattgatgtatggggttccttttgaatttcctccggaagctcagtcaaaagattttctgattcctattggaaaagccaaaatagaaaggcaaggaacacatataactgtggtttcccattcaagacctgtgggccactgcttagaagctgcagcagtgctatctaaagaaggagttgaatgtgaggtgataaatatgcgtaccattagaccaatggacatggaaaccatagaagccagtgtcatgaagacaaatcatcttgtaactgtggaaggaggctggccacagtttggagtaggagctgaaatctgtgccaggatcatggaaggtcctgcgttcaatttcctggatgctcctgctgttcgtgtcactggtgctgatgtccctatgccttatgcaaagattctagaggacaactctatacctcaggtcaaagacatcatatttgcaataaagaaaacattaaatatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - isocitrate dehydrogenase 3 (NAD+) beta
- chromosome 16 open reading frame 35
- nei endonuclease VIII-like 1 (E. coli)
- chromosome 12 open reading frame 41

Buy PDHB-pyruvate dehydrogenase (lipoamide) beta Gene now

Add to cart