IDH3B-isocitrate dehydrogenase 3 (NAD+) beta Gene View larger

IDH3B-isocitrate dehydrogenase 3 (NAD+) beta Gene

PTXBC001960

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IDH3B-isocitrate dehydrogenase 3 (NAD+) beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IDH3B-isocitrate dehydrogenase 3 (NAD+) beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001960
Product type: DNA & cDNA
Ncbi symbol: IDH3B
Origin species: Human
Product name: IDH3B-isocitrate dehydrogenase 3 (NAD+) beta Gene
Size: 2ug
Accessions: BC001960
Gene id: 3420
Gene description: isocitrate dehydrogenase 3 (NAD+) beta
Synonyms: RP46; isocitrate dehydrogenase [NAD] subunit beta, mitochondrial; NAD(+)-specific ICDH subunit beta; isocitrate dehydrogenase 3 (NAD+) beta; isocitric dehydrogenase subunit beta; isocitrate dehydrogenase 3 (NAD(+)) beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcattgagcggagtccgctggctgacccgagcgctggtctccgccgggaaccctggggcatggagaggtctgagtacctcggccgcggcgcacgctgcatcgcggagccaggccgaggacgtgagggtggagggctcctttcccgtgaccatgcttccgggagacggtgtggggcctgagctgatgcacgccgtcaaggaggtgttcaaggctgccgctgtcccagtggagttccaggagcaccacctgagtgaggtgcagaatatggcatctgaggagaagctggagcaggtgctgagttccatgaaggagaacaaagtggccatcattggaaagattcataccccgatggagtataagggggagctagcctcctatgatatgcggctgaggcgtaagttggacttatttgccaacgtagtccatgtgaagtcacttcctgggtatatgactcggcacaacaatctagacctggtgatcattcgagagcagacagaaggggagtacagctctctggaacatgagagtgcaaggggtgtgattgagtgtttgaagattgtcacacgagccaagtctcagcggattgcaaagttcgcctttgactatgccaccaagaaggggcggggcaaggtcactgctgtccacaaggccaacatcatgaaacttggggatgggttgttcctgcagtgctgtgaggaagttgctgaactgtaccccaaaatcaaatttgagacaatgatcatagacaactgctgcatgcagctggtgcagaatccttaccagtttgatgtgcttgtgatgcccaatctctatgggaacattattgacaatctggctgctggcctggttgggggagctggtgtggtccctggtgagagctatagtgcagaatacgcagtctttgagacgggtgcccggcacccatttgcccaggcagtgggcaggaatatagccaatcccacggccatgctgctgtcggcttccaacatgctgcggcatcttaatcttgagtatcactccagcatgatcgcagatgcggtgaagaaggtgatcaaagttggcaaggtgcggactcgagacatgggcggctacagcaccacaaccgacttcatcaagtctgtcatcggtcacctgcagactaaagggagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 16 open reading frame 35
- nei endonuclease VIII-like 1 (E. coli)
- chromosome 12 open reading frame 41
- solute carrier family 25, member 46

Buy IDH3B-isocitrate dehydrogenase 3 (NAD+) beta Gene now

Add to cart