Login to display prices
Login to display prices
SCAMP3-secretory carrier membrane protein 3 Gene View larger

SCAMP3-secretory carrier membrane protein 3 Gene

PTXBC005135

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCAMP3-secretory carrier membrane protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCAMP3-secretory carrier membrane protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005135
Product type: DNA & cDNA
Ncbi symbol: SCAMP3
Origin species: Human
Product name: SCAMP3-secretory carrier membrane protein 3 Gene
Size: 2ug
Accessions: BC005135
Gene id: 10067
Gene description: secretory carrier membrane protein 3
Synonyms: C1orf3; secretory carrier-associated membrane protein 3; propin 1; secretory carrier membrane protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcagagcagagacggcggaaacccgttcgccgagcccagcgagcttgacaacccctttcaggacccagctgtgatccagcaccgacccagccggcagtatgccacgcttgacgtctacaacccttttgagacccgggagccaccaccagcctatgagcctccagcccctgccccattgcctccaccctcagctccctccttgcagccctcgagaaagctcagccccacagaacctaagaactatggctcatacagcactcaggcctcagctgcagcagccacagctgagctgctgaagaaacaggaggagctcaaccggaaggcagaggagttggaccgaagggagcgagagctgcagcatgctgccctgggaggcacagctactcgacagaacaattggccccctctaccttctttttgtccagttcagccctgctttttccaggacatctccatggagatcccccaagaatttcagaagactgtatccaccatgtactacctctggatgtgcagcacgctggctcttctcctgaacttcctcgcctgcctggccagcttctgtgtggaaaccaacaatggcgcaggctttgggctttctatcctctgggtcctccttttcactccctgctcctttgtctgctggtaccgccccatgtataaggctttccggagtgacagttcattcaatttcttcgttttcttcttcattttcttcgtccaggatgtgctctttgtcctccaggccattggtatcccaggttggggattcagtggctggatctctgctctggtggtgccgaagggcaacacagcagtatccgtgctcatgctgctggtcgccctgctcttcactggcattgctgtgctaggaattgtcatgctgaaacggatccactccttataccgccgcacaggtgccagctttcagaaggcccagcaagaatttgctgctggtgtcttctccaaccctgcggtgcgaaccgcagctgccaatgcagccgctggggctgctgaaaatgccttccgggccccgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - rhabdoid tumor deletion region gene 1
- single-stranded DNA binding protein 2
- solute carrier family 35, member C1
- nucleosome assembly protein 1-like 4