SCAMP1-secretory carrier membrane protein 1 Gene View larger

SCAMP1-secretory carrier membrane protein 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCAMP1-secretory carrier membrane protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SCAMP1-secretory carrier membrane protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015065
Product type: DNA & cDNA
Ncbi symbol: SCAMP1
Origin species: Human
Product name: SCAMP1-secretory carrier membrane protein 1 Gene
Size: 2ug
Accessions: BC015065
Gene id: 9522
Gene description: secretory carrier membrane protein 1
Synonyms: SCAMP; SCAMP37; secretory carrier-associated membrane protein 1; secretory carrier membrane protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggatttcgacagtaacccgtttgccgacccggatctcaacaatcccttcaaggatccatcagttacacaagtgacaagaaatgttccaccaggacttgatgaatataatccattctcggattctagaacacctccaccaggcggtgtgaagatgcctaatgtacccaatacacaaccagcaataatgaaaccaacagaggaacatccagcttatacacagattgcaaaggaacatgcattggcccaagctgaacttcttaagcgccaggaagaactagaaagaaaagccgcagaattagatcgtcgggaacgagaaatgcaaaacctcagtcaacatggtagaaaaaataattggccacctcttcctagcaattttcctgtcggaccttgtttctatcaggatttttctgtagacattcctgtagaattccaaaagacagtaaagcttatgtactacttgtggatgttccatgcagtaacactgtttctaaatatcttcggatgcttggcttggttttgtgttgattctgcaagagcggttgattttggattgagtatcctgtggttcttgctttttactccttgttcatttgtctgttggtacagaccactttatggagctttcaggagtgacagttcatttagattctttgtattcttcttcgtctatatttgtcagtttgctgtacatgtactccaagctgcaggatttcataactggggcaattgtggttggatttcatcccttactggtctcaaccaaaatattcctgttggaatcatgatgataatcatagcagcacttttcacagcatcagcagtcatctcactagttatgttcaaaaaagtacatggactatatcgcacaacaggtgctagttttgagaaggcccaacaggagtttgcaacaggtgtgatgtccaacaaaactgtccagaccgcagctgcaaatgcagcttcaactgcagcatctagtgcagctcagaatgctttcaagggtaaccagatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - secretory carrier membrane protein 3
- rhabdoid tumor deletion region gene 1
- single-stranded DNA binding protein 2
- solute carrier family 35, member C1

Buy SCAMP1-secretory carrier membrane protein 1 Gene now

Add to cart