EIF3G-eukaryotic translation initiation factor 3, subunit G Gene View larger

EIF3G-eukaryotic translation initiation factor 3, subunit G Gene

PTXBC008469

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF3G-eukaryotic translation initiation factor 3, subunit G Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF3G-eukaryotic translation initiation factor 3, subunit G Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008469
Product type: DNA & cDNA
Ncbi symbol: EIF3G
Origin species: Human
Product name: EIF3G-eukaryotic translation initiation factor 3, subunit G Gene
Size: 2ug
Accessions: BC008469
Gene id: 8666
Gene description: eukaryotic translation initiation factor 3, subunit G
Synonyms: EIF3-P42; EIF3S4; eIF3-delta; eIF3-p44; eukaryotic translation initiation factor 3 subunit G; eukaryotic translation initiation factor 3 RNA-binding subunit; eukaryotic translation initiation factor 3 subunit p42; eukaryotic translation initiation factor 3, subunit 4 delta, 44kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctactggagactttgattcgaagcccagttgggccgaccaggtggaggaggagggggaggacgacaaatgtgtcaccagcgagctcctcaaggggatccctctggccacaggtgacaccagcccagagccagagctactgccgggagctccactgccgcctcccaaggaggtcatcaacggaaacataaagacagtgacagagtacaagatagatgaggatggcaagaagttcaagattgtccgcaccttcaggattgagacccggaaggcttcaaaggctgtcgcaaggaggaagaactggaagaagttcgggaactcagagtttgacccccccggacccaatgtggccaccaccactgtcagtgacgatgtctctatgacgttcatcaccagcaaagaggacctgaactgccaggaggaggaggaccctatgaacaaactcaagggccagaagatcgtgtcctgccgcatctgcaagggcgaccactggaccacccgctgcccctacaaggatacgctggggcccatgcagaaggagctggccgagcagctgggcctgtctactggcgagaaggagaagctgccgggagagctagagccggtgcaggccacgcagaacaagacagggaagtatgtgccgccgagcctgcgcgacggggccagccgccgcggggagtccatgcagcccaaccgcagagccgacgacaacgccaccatccgtgtcaccaacttgtcagaggacacgcgtgagaccgacctgcaggagctcttccggcctttcggctctatctcccgcatctacctggctaaggacaagaccactggccaatccaagggctttgccttcatcagcttccaccgccgcgaggatgctgcgcgtgccattgccggggtgtccggctttggctacgaccacctcatcctcaacgtcgagtgggccaagccgtccaccaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - membrane bound O-acyltransferase domain containing 7
- eukaryotic translation initiation factor 3, subunit F
- wingless-type MMTV integration site family, member 5B
- transcriptional adaptor 3 (NGG1 homolog, yeast)-like

Buy EIF3G-eukaryotic translation initiation factor 3, subunit G Gene now

Add to cart