Login to display prices
Login to display prices
EIF3G-eukaryotic translation initiation factor 3, subunit G Gene View larger

EIF3G-eukaryotic translation initiation factor 3, subunit G Gene

PTXBC008469

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF3G-eukaryotic translation initiation factor 3, subunit G Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF3G-eukaryotic translation initiation factor 3, subunit G Gene

Proteogenix catalog: PTXBC008469
Ncbi symbol: EIF3G
Product name: EIF3G-eukaryotic translation initiation factor 3, subunit G Gene
Size: 2ug
Accessions: BC008469
Gene id: 8666
Gene description: eukaryotic translation initiation factor 3, subunit G
Synonyms: EIF3-P42; EIF3S4; eIF3-delta; eIF3-p44; eukaryotic translation initiation factor 3 subunit G; eukaryotic translation initiation factor 3 RNA-binding subunit; eukaryotic translation initiation factor 3 subunit p42; eukaryotic translation initiation factor 3, subunit 4 delta, 44kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctactggagactttgattcgaagcccagttgggccgaccaggtggaggaggagggggaggacgacaaatgtgtcaccagcgagctcctcaaggggatccctctggccacaggtgacaccagcccagagccagagctactgccgggagctccactgccgcctcccaaggaggtcatcaacggaaacataaagacagtgacagagtacaagatagatgaggatggcaagaagttcaagattgtccgcaccttcaggattgagacccggaaggcttcaaaggctgtcgcaaggaggaagaactggaagaagttcgggaactcagagtttgacccccccggacccaatgtggccaccaccactgtcagtgacgatgtctctatgacgttcatcaccagcaaagaggacctgaactgccaggaggaggaggaccctatgaacaaactcaagggccagaagatcgtgtcctgccgcatctgcaagggcgaccactggaccacccgctgcccctacaaggatacgctggggcccatgcagaaggagctggccgagcagctgggcctgtctactggcgagaaggagaagctgccgggagagctagagccggtgcaggccacgcagaacaagacagggaagtatgtgccgccgagcctgcgcgacggggccagccgccgcggggagtccatgcagcccaaccgcagagccgacgacaacgccaccatccgtgtcaccaacttgtcagaggacacgcgtgagaccgacctgcaggagctcttccggcctttcggctctatctcccgcatctacctggctaaggacaagaccactggccaatccaagggctttgccttcatcagcttccaccgccgcgaggatgctgcgcgtgccattgccggggtgtccggctttggctacgaccacctcatcctcaacgtcgagtgggccaagccgtccaccaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: