Login to display prices
Login to display prices
EIF3F-eukaryotic translation initiation factor 3, subunit F Gene View larger

EIF3F-eukaryotic translation initiation factor 3, subunit F Gene

PTXBC000490

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF3F-eukaryotic translation initiation factor 3, subunit F Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF3F-eukaryotic translation initiation factor 3, subunit F Gene

Proteogenix catalog: PTXBC000490
Ncbi symbol: EIF3F
Product name: EIF3F-eukaryotic translation initiation factor 3, subunit F Gene
Size: 2ug
Accessions: BC000490
Gene id: 8665
Gene description: eukaryotic translation initiation factor 3, subunit F
Synonyms: deubiquitinating enzyme eIF3f; EIF3S5; eIF3-p47; eukaryotic translation initiation factor 3 subunit F; eIF-3-epsilon; eIF3-epsilon; eukaryotic translation initiation factor 3, subunit 5 (epsilon, 47kD); eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccacaccggcggtaccagtaagtgctcctccggccacgccaaccccagtcccggcggcggccccagcctcagttccagcgccaacgccagcaccggctgcggctccggttcccgctgcggctccagcctcatcctcagaccctgcggcagcagcggctgcaactgcggctcctggccagaccccggcctcagcgcaagctccagcgcagaccccagcgcccgctctgcctggtcctgctcttccagggcccttccccggcggccgcgtggtcaggctgcacccagtcattttggcctccattgtggacagctacgagagacgcaacgagggtgctgcccgagttatcgggaccctgttgggaactgtcgacaaacactcagtggaggtcaccaattgcttttcagtgccgcacaatgagtcagaagatgaagtggctgttgacatggaatttgctaagaatatgtatgaactgcataaaaaagtttctccaaatgagctcatcctgggctggtacgctacgggccatgacatcacagagcactctgtgctgatccatgagtactacagccgagaggcccccaaccccatccacctcactgtggacacaagtctccagaacggccgcatgagcatcaaagcctacgtcagcactttaatgggagtccctgggaggaccatgggagtgatgttcacgcctctgacagtgaaatacgcgtactacgacactgaacgcatcggagttgacctgatcatgaagacctgctttagccccaacagagtgattggactctcaagtgacttgcagcaagtaggaggggcatcagctcgcatccaggatgccctgagtacagtgttgcaatatgcagaggatgtactgtctggaaaggtgtcagctgacaatactgtgggccgcttcctgatgagcctggttaaccaagtaccgaaaatagttcccgatgactttgagaccatgctcaacagcaacatcaatgaccttttgatggtgacctacctggccaacctcacacagtcacagattgcactcaatgaaaaacttgtaaacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: