Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EIF3F-eukaryotic translation initiation factor 3, subunit F Gene
PTXBC000490
New product
Data sheet of EIF3F-eukaryotic translation initiation factor 3, subunit F Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF3F-eukaryotic translation initiation factor 3, subunit F Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000490 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF3F |
| Origin species: | Human |
| Product name: | EIF3F-eukaryotic translation initiation factor 3, subunit F Gene |
| Size: | 2ug |
| Accessions: | BC000490 |
| Gene id: | 8665 |
| Gene description: | eukaryotic translation initiation factor 3, subunit F |
| Synonyms: | deubiquitinating enzyme eIF3f; EIF3S5; eIF3-p47; eukaryotic translation initiation factor 3 subunit F; eIF-3-epsilon; eIF3-epsilon; eukaryotic translation initiation factor 3, subunit 5 (epsilon, 47kD); eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccacaccggcggtaccagtaagtgctcctccggccacgccaaccccagtcccggcggcggccccagcctcagttccagcgccaacgccagcaccggctgcggctccggttcccgctgcggctccagcctcatcctcagaccctgcggcagcagcggctgcaactgcggctcctggccagaccccggcctcagcgcaagctccagcgcagaccccagcgcccgctctgcctggtcctgctcttccagggcccttccccggcggccgcgtggtcaggctgcacccagtcattttggcctccattgtggacagctacgagagacgcaacgagggtgctgcccgagttatcgggaccctgttgggaactgtcgacaaacactcagtggaggtcaccaattgcttttcagtgccgcacaatgagtcagaagatgaagtggctgttgacatggaatttgctaagaatatgtatgaactgcataaaaaagtttctccaaatgagctcatcctgggctggtacgctacgggccatgacatcacagagcactctgtgctgatccatgagtactacagccgagaggcccccaaccccatccacctcactgtggacacaagtctccagaacggccgcatgagcatcaaagcctacgtcagcactttaatgggagtccctgggaggaccatgggagtgatgttcacgcctctgacagtgaaatacgcgtactacgacactgaacgcatcggagttgacctgatcatgaagacctgctttagccccaacagagtgattggactctcaagtgacttgcagcaagtaggaggggcatcagctcgcatccaggatgccctgagtacagtgttgcaatatgcagaggatgtactgtctggaaaggtgtcagctgacaatactgtgggccgcttcctgatgagcctggttaaccaagtaccgaaaatagttcccgatgactttgagaccatgctcaacagcaacatcaatgaccttttgatggtgacctacctggccaacctcacacagtcacagattgcactcaatgaaaaacttgtaaacctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - wingless-type MMTV integration site family, member 5B - transcriptional adaptor 3 (NGG1 homolog, yeast)-like - transcriptional adaptor 3 (NGG1 homolog, yeast)-like - transcriptional adaptor 2 (ADA2 homolog, yeast)-like |