WNT5B-wingless-type MMTV integration site family, member 5B Gene View larger

WNT5B-wingless-type MMTV integration site family, member 5B Gene

PTXBC001749

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WNT5B-wingless-type MMTV integration site family, member 5B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WNT5B-wingless-type MMTV integration site family, member 5B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001749
Product type: DNA & cDNA
Ncbi symbol: WNT5B
Origin species: Human
Product name: WNT5B-wingless-type MMTV integration site family, member 5B Gene
Size: 2ug
Accessions: BC001749
Gene id: 81029
Gene description: wingless-type MMTV integration site family, member 5B
Synonyms: protein Wnt-5b; WNT-5B protein; wingless-type MMTV integration site family, member 5B; Wnt family member 5B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccagcctgctgctgctgttcacggctgctctgctgtccagctgggctcagcttctgacagacgccaactcctggtggtcattagctttgaacccggtgcagagacccgagatgtttatcatcggtgcccagcccgtgtgcagtcagcttcccgggctctcccctggccagaggaagctgtgccaattgtaccaggagcacatggcctacataggggagggagccaagactggcatcaaggaatgccagcaccagttccggcagcggcggtggaattgcagcacagcggacaacgcatctgtctttgggagagtcatgcagataggcagccgagagaccgccttcacccacgcggtgagcgccgcgggcgtggtcaacgccatcagccgggcctgccgcgagggcgagctctccacctgcggctgcagccggacggcgcggcccaaggacctgccccgggactggctgtggggcggctgtggggacaacgtggagtacggctaccgcttcgccaaggagtttgtggatgcccgggagcgagagaagaactttgccaaaggatcagaggagcagggccgggtgctcatgaacctgcaaaacaacgaggccggtcgcagggctgtgtataagatggcagacgtagcctgcaaatgccacggcgtctcggggtcctgcagcctcaagacctgctggctgcagctggccgagttccgcaaggtcggggaccggctgaaggagaagtacgacagcgcggccgccatgcgcgtcacccgcaagggccggctggagctggtcaacagccgcttcacccagcccaccccggaggacctggtctatgtggaccccagccccgactactgcctgcgcaacgagagcacgggctccctgggcacgcagggccgcctctgcaacaagacctcggagggcatggatggctgtgagctcatgtgctgcgggcgtggctacaaccagttcaagagcgtgcaggtggagcgctgccactgcaagttccactggtgctgcttcgtcaggtgtaagaagtgcacggagatcgtggaccagtacatctgtaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcriptional adaptor 3 (NGG1 homolog, yeast)-like
- transcriptional adaptor 3 (NGG1 homolog, yeast)-like
- transcriptional adaptor 2 (ADA2 homolog, yeast)-like
- eukaryotic translation initiation factor 3, subunit E

Buy WNT5B-wingless-type MMTV integration site family, member 5B Gene now

Add to cart