TADA2L-transcriptional adaptor 2 (ADA2 homolog, yeast)-like Gene View larger

TADA2L-transcriptional adaptor 2 (ADA2 homolog, yeast)-like Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TADA2L-transcriptional adaptor 2 (ADA2 homolog, yeast)-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TADA2L-transcriptional adaptor 2 (ADA2 homolog, yeast)-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011753
Product type: DNA & cDNA
Ncbi symbol: TADA2L
Origin species: Human
Product name: TADA2L-transcriptional adaptor 2 (ADA2 homolog, yeast)-like Gene
Size: 2ug
Accessions: BC011753
Gene id: 6871
Gene description: transcriptional adaptor 2 (ADA2 homolog, yeast)-like
Synonyms: TADA2L; ADA2; ADA2A; KL04P; hADA2; transcriptional adapter 2-alpha; ADA2-like protein; transcriptional adaptor 2 alpha; transcriptional adaptor 2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccgtttgggttcctttagcaatgatccctctgataagccaccttgccgaggctgctcctcctacctcatggagccttatatcaagtgtgctgaatgtgggccacctccttttttcctctgcttgcagtgtttcactcgaggctttgagtacaagaaacatcaaagcgatcatacttatgaaataatgacttcagattttcctgtccttgatcccagctggactgctcaagaagaaatggcccttttagaagctgtgatggactgtggctttggaaattggcaggatgtagccaatcaaatgtgcaccaagaccaaggaggagtgtgagaagcactatatgaagcatttcatcaataaccctctgtttgcatctaccctgctgaacctgaaacaagcagaggaagcaaaaactgctgacacagccattccatttcactctacagatgaccctccccgacctacctttgactccttgctttctcgggacatggccgggtacatgccagctcgagcagatttcattgaggaatttgacaattatgcagaatgggacttgagagacattgattttgttgaagatgactcggacattttacatgctctgaagatggctgtggtagatatctatcattccaggttaaaggagagacaaagacgaaaaaaaattataagagaccatggattaatcaaccttagaaagtttcaattaatggaacggcggtatcccaaggaggtccaggacctgtatgaaacaatgaggcgatttgcaagaattgtggggccagtggaacatgacaaattcattgaaagccatgcattggaatttgaactccgaagggaaatcaagaggctccaagaatacaggacagcaggcattaccaatttttgtagtgccagaacctacgatcacctcaagaagacacgggaggaagagcgccttaaacgcactatgctctcagaagttctccagtatatccaggacagtagtgcttgccagcagtggctccgccggcaagctgacattgattccggcctgagtccttccattccaatggcttcgaattcaggtagacggagtgcaccacccttgaacctcactggcctccctggcacagagaagctgaatgaaaaagaaaaggagctctgtcagatggtgaggttggtccctggagcctatttagaatacaaatctgctctattgaacgaatgtaacaagcaaggaggcttaagactggcgcaggcaagagcactcatcaagatagatgtgaacaaaacccggaaaatctatgatttcctcatcagagaaggatacatcactaaaggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 3, subunit E
- eukaryotic translation initiation factor 3, subunit E
- cleavage and polyadenylation specific factor 6, 68kDa
- signal recognition particle receptor (docking protein)

Buy TADA2L-transcriptional adaptor 2 (ADA2 homolog, yeast)-like Gene now

Add to cart