Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CPSF6-cleavage and polyadenylation specific factor 6, 68kDa Gene
PTXBC005000
New product
Data sheet of CPSF6-cleavage and polyadenylation specific factor 6, 68kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CPSF6-cleavage and polyadenylation specific factor 6, 68kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005000 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CPSF6 |
| Origin species: | Human |
| Product name: | CPSF6-cleavage and polyadenylation specific factor 6, 68kDa Gene |
| Size: | 2ug |
| Accessions: | BC005000 |
| Gene id: | 11052 |
| Gene description: | cleavage and polyadenylation specific factor 6, 68kDa |
| Synonyms: | CFIM; CFIM68; HPBRII-4; HPBRII-7; cleavage and polyadenylation specificity factor subunit 6; CPSF 68 kDa subunit; cleavage and polyadenylation specific factor 6, 68kDa; cleavage and polyadenylation specificity factor 68 kDa subunit; cleavage factor Im complex 68 kDa subunit; pre-mRNA cleavage factor I, 68kD subunit; pre-mRNA cleavage factor Im (68kD); pre-mRNA cleavage factor Im 68 kDa subunit; protein HPBRII-4/7; cleavage and polyadenylation specific factor 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggacggcgtggaccacatagacatttacgcggatgtcggcgaagagttcaaccaggaagctgaatatggtgggcatgatcagatagatttgtatgacgatgtcatatctccatctgcaaataatggagatgccccagaagaccgagattacatggatactctcccaccaactgttggtgatgatgtgggtaaaggagcagcaccaaatgttgtctatacatatactggaaagagaattgcattatatattggaaatctaacatggtggacaacagatgaagacttaactgaagcagttcattctttgggagtaaatgatattttggagataaaattttttgaaaatcgagcaaatggccagtcaaaggggtttgcccttgttggtgttggatctgaagcatcttcaaaaaagttaatggatctgttacctaaaagagaacttcatggtcagaatcctgttgtaactccatgcaataaacagttcctgagtcaatttgaaatgcagtccaggaaaactacacaatcaggacaaatgtctggggaaggtaaagctggtcctcctctagctgggcctcctaatcgaggagatcgccctccaccaccagttctttttcctggacaaccttttgggcagcctccattgggtccacttcctcctggccctccacctccagttccaggctacggcccccctcctggcccaccacctccacaacagggaccacctccacctccaggcccctttccacctcgtccacccggtccacttgggccaccccttacactagctcctcctccgcatcttcctggaccacctccaggtgccccaccgccagctccgcatgtgaacccagctttctttcctccaccaactaacagtggcatgcctacatcagatagccgaggtccaccaccaacagatccatatgggcgacctccaccatatgataggggtgactatggcccccctggaagggaaatggatactgcaagaacgccattgagtgaagctgaatttgaagaaatcatgaatagaaatagggcaatctcaagcagtgctatttcgagagctgtgtctgatgccagtgctggtgattatgggagtgctattgagacactggtaactgcaatttctttaattaaacaatccaaagtatctgctgatgatcgttgcaaagttcttattagttctttgcaagattgccttcatggaattgagtccaagtcttatggttctggatcaagacgtgaacgatcaagagagagggaccatagtagatcacgagaaaagagtcgacgtcataaatcccgtagtagagaccgtcatgacgattattacagagagagaagcagagaacgagagaggcaccgggatcgtgaccgagaccgtgaccgagagcgtgaccgagagcgcgaatatcgtcatcgttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal recognition particle receptor (docking protein) - TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) - guanine nucleotide binding protein (G protein), beta 5 - LLP homolog, long-term synaptic facilitation (Aplysia) |