Login to display prices
Login to display prices
GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene View larger

GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011671
Product type: DNA & cDNA
Ncbi symbol: GNB5
Origin species: Human
Product name: GNB5-guanine nucleotide binding protein (G protein), beta 5 Gene
Size: 2ug
Accessions: BC011671
Gene id: 10681
Gene description: guanine nucleotide binding protein (G protein), beta 5
Synonyms: GB5; IDDCA; LADCI; guanine nucleotide-binding protein subunit beta-5; G protein, beta subunit 5L; G protein, beta-5 subunit; gbeta5; guanine nucleotide binding protein (G protein), beta 5; guanine nucleotide-binding protein, beta subunit 5L; transducin beta chain 5; G protein subunit beta 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaccgaggggctgcacgagaacgagacgctggcgtcgctgaagagcgaggccgagagcctcaagggcaagctggaggaggagcgagccaagctgcacgatgtggagctgcaccaggtggcggagcgggtggaggccctggggcagtttgtcatgaagaccagaaggaccctcaaaggccacgggaacaaagtcctgtgcatggactggtgcaaagataagaggaggatcgtgagctcgtcacaggatgggaaggtgatcgtgtgggattccttcaccacaaacaaggtgaggcattgttcccagccacgttatagaggcttcagaatcccagcctacttaaaggtgctctggtccagctgcccggccctgtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LLP homolog, long-term synaptic facilitation (Aplysia)
- proteasome (prosome, macropain) subunit, beta type, 3
- coenzyme Q3 homolog, methyltransferase (S. cerevisiae)
- major histocompatibility complex, class II, DO beta