Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene
PTXBC006002
New product
Data sheet of LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006002 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LLPH |
| Origin species: | Human |
| Product name: | LLPH-LLP homolog, long-term synaptic facilitation (Aplysia) Gene |
| Size: | 2ug |
| Accessions: | BC006002 |
| Gene id: | 84298 |
| Gene description: | LLP homolog, long-term synaptic facilitation (Aplysia) |
| Synonyms: | C12orf31; hLLP; protein LLP homolog; LLP homolog, long-term synaptic facilitation (Aplysia); human LAPS18-like protein; LLP homolog, long-term synaptic facilitation |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctaaaagcttacggagtaagtggaaaagaaagatgcgtgctgaaaagagaaaaaagaatgccccaaaggaggccagcaggcttaaaagtattctcaaactagacggtgatgttttaatgaaagatgttcaagagatagcaactgtggtggtacccaaacccaaacattgccaagagaaaatgcaatgtgaggtaaaagatgaaaaagatgacatgaaaatggagactgatattaagagaaacaaaaagactcttctagaccagcatggacagtacccaatatggatgaaccaaaggcaaagaaaaaggctgaaggcaaagcgagagaaaagaaaggggaaaagcaaagcaaaagcagtgaaagtggcaaagggtttggcctggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, beta type, 3 - coenzyme Q3 homolog, methyltransferase (S. cerevisiae) - major histocompatibility complex, class II, DO beta - proline synthetase co-transcribed homolog (bacterial) |