Cart 4 Product Products 457,52 € (empty)
-
1 x EIF3F-euka...121,50 € -
1 x ZFYVE19-zi...121,50 € -
1 x NPM1-nucle...121,50 € -
No products
To be determined Shipping
457,52 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 457,52 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 457,52 €
View larger 
TADA3L-transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene
PTXBC009240
New product
Data sheet of TADA3L-transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TADA3L-transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009240 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TADA3L |
| Origin species: | Human |
| Product name: | TADA3L-transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene |
| Size: | 2ug |
| Accessions: | BC009240 |
| Gene id: | 10474 |
| Gene description: | transcriptional adaptor 3 (NGG1 homolog, yeast)-like |
| Synonyms: | TADA3L; ADA3; NGG1; STAF54; hADA3; transcriptional adapter 3; ADA3 homolog; ADA3-like protein; alteration/deficiency in activation 3; transcriptional adaptor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgagttgaaagactgccccttgcagttccacgacttcaagtctgtggatcacctgaaggtctgtccccgctacacggcagtgctggcacgctctgaggatgatggcatcggcatcgaggagctggacaccctgcagctggagctggagaccctgctgtcttctgccagccggcgcctgcgtgtgcttgaggccgaaacccagatcctcaccgactggcaggataagaaaggtgacagacgattcctgaagctgggtcgagaccatgaacttggagctccccccaaacatgggaagcccaagaagcagaaactggaagggaaggcaggacatgggccgggccctggcccaggacggcccaaatccaaaaaccttcagcccaagatccaggaatatgaattcactgatgaccctatcgacgtgccacggatccccaaaaatgatgcccccaacaggttctgggcttcagtggagccctactgtgctgacatcaccagcgaggaggtccgcacacttgaggagttactgaagcccccagaagatgaggctgagcattacaagatcccacccctggggaagcactactcccagcgctgggcccaggaggacctgctggaggagcagaaggatggggcccgggcagcggctgtggctgacaagaagaaaggcctcatggggccactgaccgaactggacactaaagatgtggatgccctgctgaagaagtctgaggcccagcatgaacagccggaagatggatgcccctttggtgccctgacgcagcgcctcctgcaggccctggtggaggaaaatattatttcccctatggaggattctcctattcctgacatgtctgggaaagaatcaggggctgacggggcaagcacctcccctcgcaatcagaacaagcccttcagtgtgccgcatactaagtccctggagagccgcatcaaggaggagctaattgcccagggccttttggagtctgaggaccgccccgcagaggactccgaggatgaggtccttgctgagcttcgcaaacggcaggctgagctgaaggcacttagtgcccacaaccgcaccaagaagcacgacctgctgaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcriptional adaptor 3 (NGG1 homolog, yeast)-like - transcriptional adaptor 2 (ADA2 homolog, yeast)-like - eukaryotic translation initiation factor 3, subunit E - eukaryotic translation initiation factor 3, subunit E |