Login to display prices
Login to display prices
TADA3L-transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene View larger

TADA3L-transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TADA3L-transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TADA3L-transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009240
Product type: DNA & cDNA
Ncbi symbol: TADA3L
Origin species: Human
Product name: TADA3L-transcriptional adaptor 3 (NGG1 homolog, yeast)-like Gene
Size: 2ug
Accessions: BC009240
Gene id: 10474
Gene description: transcriptional adaptor 3 (NGG1 homolog, yeast)-like
Synonyms: TADA3L; ADA3; NGG1; STAF54; hADA3; transcriptional adapter 3; ADA3 homolog; ADA3-like protein; alteration/deficiency in activation 3; transcriptional adaptor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgagttgaaagactgccccttgcagttccacgacttcaagtctgtggatcacctgaaggtctgtccccgctacacggcagtgctggcacgctctgaggatgatggcatcggcatcgaggagctggacaccctgcagctggagctggagaccctgctgtcttctgccagccggcgcctgcgtgtgcttgaggccgaaacccagatcctcaccgactggcaggataagaaaggtgacagacgattcctgaagctgggtcgagaccatgaacttggagctccccccaaacatgggaagcccaagaagcagaaactggaagggaaggcaggacatgggccgggccctggcccaggacggcccaaatccaaaaaccttcagcccaagatccaggaatatgaattcactgatgaccctatcgacgtgccacggatccccaaaaatgatgcccccaacaggttctgggcttcagtggagccctactgtgctgacatcaccagcgaggaggtccgcacacttgaggagttactgaagcccccagaagatgaggctgagcattacaagatcccacccctggggaagcactactcccagcgctgggcccaggaggacctgctggaggagcagaaggatggggcccgggcagcggctgtggctgacaagaagaaaggcctcatggggccactgaccgaactggacactaaagatgtggatgccctgctgaagaagtctgaggcccagcatgaacagccggaagatggatgcccctttggtgccctgacgcagcgcctcctgcaggccctggtggaggaaaatattatttcccctatggaggattctcctattcctgacatgtctgggaaagaatcaggggctgacggggcaagcacctcccctcgcaatcagaacaagcccttcagtgtgccgcatactaagtccctggagagccgcatcaaggaggagctaattgcccagggccttttggagtctgaggaccgccccgcagaggactccgaggatgaggtccttgctgagcttcgcaaacggcaggctgagctgaaggcacttagtgcccacaaccgcaccaagaagcacgacctgctgaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcriptional adaptor 3 (NGG1 homolog, yeast)-like
- transcriptional adaptor 2 (ADA2 homolog, yeast)-like
- eukaryotic translation initiation factor 3, subunit E
- eukaryotic translation initiation factor 3, subunit E