Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MBOAT7-membrane bound O-acyltransferase domain containing 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MBOAT7-membrane bound O-acyltransferase domain containing 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006309 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MBOAT7 |
| Origin species: | Human |
| Product name: | MBOAT7-membrane bound O-acyltransferase domain containing 7 Gene |
| Size: | 2ug |
| Accessions: | BC006309 |
| Gene id: | 79143 |
| Gene description: | membrane bound O-acyltransferase domain containing 7 |
| Synonyms: | BB1; LENG4; LPIAT; LRC4; MBOA7; MRT57; OACT7; hMBOA-7; lysophospholipid acyltransferase 7; 1-acylglycerophosphatidylinositol O-acyltransferase; LPLAT 7; bladder and breast carcinoma-overexpressed gene 1 protein; h-mboa-7; leukocyte receptor cluster (LRC) member 4; lyso-PI acyltransferase; lysophosphatidylinositol acyltransferase; malignant cell expression-enhanced gene/tumor progression-enhanced; membrane bound O-acyltransferase domain containing 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgcctgaagaatggacgtatctagtggttcttcttatctccatccccatcggcttcctctttaagaaagccggtcctgggctgaagagatggggagcagccgctgtgggcctggggctcaccctgttcacctgtggcccccacactttgcattctctggtcaccatcctcgggacctgggccctcattcaggcccagccctgctcctgccacgccctggctctggcctggactttctcctatctcctgttcttccgagccctcagcctcctgggcctgcccactcccacgcccttcaccaatgccgtccagctgctgctgacgctgaagctggtgagcctggccagtgaagtccaggacctgcatctggcccagaggaaggaaatggcctcaggcttcagcaaggggcccaccctggggctgctgcccgacgtgccctccctgatggagacactcagctacagctactgctacgtgggaatcatgacaggcccgttcttccgctaccgcacctacctggactggctggagcagcccttccccggggcagtgcccagcctgcggcccctgctgcgccgcgcctggccggccccgctcttcggcctgctgttcctgctctcctctcacctcttcccgctggaggccgtgcgcgaggacgccttctacgcccgcccgctgcccgcccgcctcttctacatgatccccgtcttcttcgccttccgcatgcgcttctacgtggcctggattgccgccgagtgcggctgcattgccgccggccttggggcctaccccgtggccgccaaagcccgggccggaggcggccccaccctccaatgcccaccccccagcagtccggagaaggcggcttccttggagtatgactatgagaccatccgcaacatcgactgctacagcacagatttctgcgtgcgggtgcgcgatggcatgcggtactggaacatgacggtgcagtggtggctggcgcagtatatctacaagagcgcacctgcccgttcctatgtcctgcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 3, subunit F - wingless-type MMTV integration site family, member 5B - transcriptional adaptor 3 (NGG1 homolog, yeast)-like - transcriptional adaptor 3 (NGG1 homolog, yeast)-like |