FSD1-fibronectin type III and SPRY domain containing 1 Gene View larger

FSD1-fibronectin type III and SPRY domain containing 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FSD1-fibronectin type III and SPRY domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FSD1-fibronectin type III and SPRY domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016442
Product type: DNA & cDNA
Ncbi symbol: FSD1
Origin species: Human
Product name: FSD1-fibronectin type III and SPRY domain containing 1 Gene
Size: 2ug
Accessions: BC016442
Gene id: 79187
Gene description: fibronectin type III and SPRY domain containing 1
Synonyms: GLFND; MIR1; fibronectin type III and SPRY domain-containing protein 1; MID1-related protein 1; fibronectin type 3 and SPRY (spla, ryanodine) domain containing (with coiled-coil motif) 1; fibronectin type 3 and SPRY domain containing 1; microtubule-associated protein GLFND; midline 1-related protein 1; fibronectin type III and SPRY domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggatgaggacagcaagattgaccactacgtgctggagtaccggcggaccaacttcgagggcccgccccgcctcaaggaggaccagccctggatggtcatcgagggcatccggcagacagagtacaccctgacaggtctcaagtttgacatgaaatacatgaacttccgtgtgaaggcctgtaacaaggcagttgcaggagagttctctgagccggtgactctggagacaccagcgttcatgttccgcctggatgcgtccacatcccaccagaacctgcgggtggatgatctctccgtggagtgggacgctatgggcgggaaggtgcaggatatcaaggctcgcgagaaagatggcaaggggcggacggcgtctcccatcaactccccagccagaggtactccatctcccaagaggatgccctcaggtcgtgggggacgggaccgcttcaccgctgagtcctacacagttctgggggacacgctgatcgacggcggggagcattactgggaggtgcgctacgagccggacagcaaggcgttcggcgtgggcgtggcctaccgcagcctgggccgcttcgagcaactgggcaagacggccgcctcctggtgcctgcacgtcaacaattggctgcaggtcagcttcacggccaagcacgccaacaaggtcaaggtgctggacgcccccgtgcccgactgcctgggtgtgcactgtgacttccaccaaggcctcctgtccttctacaatgcccgcaccaaacaagtgctgcacactttcaagaccaggttcacacagccgctgctgcctgctttcacggtatggtgtggcagcttccaggtgacgacaggcctgcaggtccccagtgctgtgcgctgcctgcaaaagcgaggcagtgctaccagcagctccaacaccagcctcacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CDC42 effector protein (Rho GTPase binding) 4
- branched chain aminotransferase 2, mitochondrial
- coagulation factor II (thrombin) receptor-like 1
- mannose-6-phosphate receptor binding protein 1

Buy FSD1-fibronectin type III and SPRY domain containing 1 Gene now

Add to cart