Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FSD1-fibronectin type III and SPRY domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FSD1-fibronectin type III and SPRY domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016442 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FSD1 |
| Origin species: | Human |
| Product name: | FSD1-fibronectin type III and SPRY domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC016442 |
| Gene id: | 79187 |
| Gene description: | fibronectin type III and SPRY domain containing 1 |
| Synonyms: | GLFND; MIR1; fibronectin type III and SPRY domain-containing protein 1; MID1-related protein 1; fibronectin type 3 and SPRY (spla, ryanodine) domain containing (with coiled-coil motif) 1; fibronectin type 3 and SPRY domain containing 1; microtubule-associated protein GLFND; midline 1-related protein 1; fibronectin type III and SPRY domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggatgaggacagcaagattgaccactacgtgctggagtaccggcggaccaacttcgagggcccgccccgcctcaaggaggaccagccctggatggtcatcgagggcatccggcagacagagtacaccctgacaggtctcaagtttgacatgaaatacatgaacttccgtgtgaaggcctgtaacaaggcagttgcaggagagttctctgagccggtgactctggagacaccagcgttcatgttccgcctggatgcgtccacatcccaccagaacctgcgggtggatgatctctccgtggagtgggacgctatgggcgggaaggtgcaggatatcaaggctcgcgagaaagatggcaaggggcggacggcgtctcccatcaactccccagccagaggtactccatctcccaagaggatgccctcaggtcgtgggggacgggaccgcttcaccgctgagtcctacacagttctgggggacacgctgatcgacggcggggagcattactgggaggtgcgctacgagccggacagcaaggcgttcggcgtgggcgtggcctaccgcagcctgggccgcttcgagcaactgggcaagacggccgcctcctggtgcctgcacgtcaacaattggctgcaggtcagcttcacggccaagcacgccaacaaggtcaaggtgctggacgcccccgtgcccgactgcctgggtgtgcactgtgacttccaccaaggcctcctgtccttctacaatgcccgcaccaaacaagtgctgcacactttcaagaccaggttcacacagccgctgctgcctgctttcacggtatggtgtggcagcttccaggtgacgacaggcctgcaggtccccagtgctgtgcgctgcctgcaaaagcgaggcagtgctaccagcagctccaacaccagcctcacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CDC42 effector protein (Rho GTPase binding) 4 - branched chain aminotransferase 2, mitochondrial - coagulation factor II (thrombin) receptor-like 1 - mannose-6-phosphate receptor binding protein 1 |