Login to display prices
Login to display prices
F2RL1-coagulation factor II (thrombin) receptor-like 1 Gene View larger

F2RL1-coagulation factor II (thrombin) receptor-like 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of F2RL1-coagulation factor II (thrombin) receptor-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about F2RL1-coagulation factor II (thrombin) receptor-like 1 Gene

Proteogenix catalog: PTXBC018130
Ncbi symbol: F2RL1
Product name: F2RL1-coagulation factor II (thrombin) receptor-like 1 Gene
Size: 2ug
Accessions: BC018130
Gene id: 2150
Gene description: coagulation factor II (thrombin) receptor-like 1
Synonyms: GPR11; PAR2; proteinase-activated receptor 2; G-protein coupled receptor 11; coagulation factor II (thrombin) receptor-like 1; protease-activated receptor 2; thrombin receptor-like 1; F2R like trypsin receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggagccccagcgcggcgtggctgctgggggccgccatcctgctagcagcctctctctcctgcagtggcaccatccaaggaaccaatagatcctctaaaggaagaagccttattggtaaggttgatggcacatcccacgtcactggaaaaggagttacagttgaaacagtcttttctgtggatgagttttctgcatctgtcctcactggaaaactgaccactgtcttccttccaattgtctacacaattgtgtttgtggtgggtttgccaagtaacggcatggccctgtgggtctttcttttccgaactaagaagaagcaccctgctgtgatttacatggccaatctggccttggctgacctcctctctgtcatctggttccccttgaagattgcctatcacatacatggcaacaactggatttatggggaagctctttgtaatgtgcttattggctttttctatggcaacatgtactgttccattctcttcatgacctgcctcagtgtgcagaggtattgggtcatcgtgaaccccatggggcactccaggaagaaggcaaacattgccattggcatctccctggcaatatggctgctgattctgctggtcaccatccctttgtatgtcgtgaagcagaccatcttcattcctgccctgaacatcacgacctgtcatgatgttttgcctgagcagctcttggtgggagacatgttcaattacttcctctctctggccattggggtctttctgttcccagccttcctcacagcctctgcctatgtgctgatgatcagaatgctgcgatcttctgccatggatgaaaactcagagaagaaaaggaagagggccatcaaactcattgtctctgtcctggccatgtacctgatctgcttcactcctagtaaccttctgcttgtggtgcattattttctgattaagagccagggccagagccatgtctatgccctgtacattgtagccctctgcctctctacccttaacagctgcatcgacccctttgtctattactttgtttcacatgatttcagggatcatgcaaagaacgctctcctttgccgaagtgtccgcactgtaaagcagatgcaagtatccctcacctcaaagaaacactccaggaaatccagctcttactcttcaagttcaaccactgttaagacctcctattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: