Login to display prices
Login to display prices
EEF1G-eukaryotic translation elongation factor 1 gamma Gene View larger

EEF1G-eukaryotic translation elongation factor 1 gamma Gene

PTXBC009865

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EEF1G-eukaryotic translation elongation factor 1 gamma Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EEF1G-eukaryotic translation elongation factor 1 gamma Gene

Proteogenix catalog: PTXBC009865
Ncbi symbol: EEF1G
Product name: EEF1G-eukaryotic translation elongation factor 1 gamma Gene
Size: 2ug
Accessions: BC009865
Gene id: 1937
Gene description: eukaryotic translation elongation factor 1 gamma
Synonyms: EF1G; GIG35; elongation factor 1-gamma; EF-1-gamma; PRO1608; eEF-1B gamma; pancreatic tumor-related protein; translation elongation factor eEF-1 gamma chain; eukaryotic translation elongation factor 1 gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctgggaccctgtacacgtatcctgaaaactggagggccttcaaggctctcatcgctgctcagtacagcggggctcaggtccgcgtgctctccgcaccaccccacttccattttggccaaaccaaccgcacccctgaatttctccgcaaatttcctgccggcaaggtcccagcatttgagggtgatgatggattctgtgtgtttgagagcaacgccattgcctactatgtgagcaatgaggagctgcggggaagtactccagaggcagcagcccaggtggtgcagtgggtgagctttgctgattccgatatagtgcccccagccagtacctgggtgttccccaccttgggcatcatgcaccacaacaaacaggccactgagaatgcaaaggaggaagtgaggcgaattctggggctgctggatgcttacttgaagacgaggacttttctggtgggcgaacgagtgacattggctgacatcacagttgtctgcaccctgttgtggctctataagcaggttctagagccttctttccgccaggcctttcccaataccaaccgctggttcctcacctgcattaaccagccccagttccgggctgtcttgggggaagtgaaactgtgtgagaagatggcccagtttgatgctaaaaagtttgcagagacccaacctaaaaaggacacaccacggaaagagaagggttcacgggaagagaagcagaagccccaggctgagcggaaggaggagaaaaaggcggctgcccctgctcctgaggaggagatggatgaatgtgagcaggcgctggctgctgagcccaaggccaaggaccccttcgctcacctgcccaagagtacctttgtgttggatgaatttaagcgcaagtactccaatgaggacacactctctgtggcactgccatatttctgggagcactttgataaggacggctggtccctgtggtactcagagtatcgcttccctgaagaactcactcagaccttcatgagctgcaatctcatcactggaatgttccagcgactggacaagctgaggaagaatgccttcgccagtgtcatcctttttggaaccaacaatagcagctccatttctggagtctgggtcttccgaggccaggagcttgcctttccgctgagtccagattggcaggtggactacgagtcatacacatggcggaaactggatcctggcagcgaggagacccagacgctggttcgagagtacttttcctgggagggggccttccagcatgtgggcaaagccttcaatcagggcaagatcttcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: