Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of UCRC-ubiquinol-cytochrome c reductase complex (7.2 kD) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UCRC-ubiquinol-cytochrome c reductase complex (7.2 kD) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005402 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UCRC |
| Origin species: | Human |
| Product name: | UCRC-ubiquinol-cytochrome c reductase complex (7.2 kD) Gene |
| Size: | 2ug |
| Accessions: | BC005402 |
| Gene id: | 29796 |
| Gene description: | ubiquinol-cytochrome c reductase complex (7.2 kD) |
| Synonyms: | UCRC; HSPC051; HSPC119; HSPC151; QCR9; UCCR7.2; cytochrome b-c1 complex subunit 9; cytochrome C1, nonheme 7kDa protein; cytochrome c1 non-heme 7 kDa protein; ubiquinol-cytochrome c reductase complex (7.2 kD); ubiquinol-cytochrome c reductase complex 7.2 kDa protein; ubiquinol-cytochrome c reductase, complex III subunit X, 7.2kDa; ubiquinol-cytochrome c reductase, complex III subunit X |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggccgcgacgttgacttcgaagttgtactccctgctgttccgcaggacctccaccttcgccctcaccatcatcgtgggcgtcatgttcttcgagcgcgccttcgatcaaggcgcggacgctatctacgaccacatcaacgaggggaagctgtggaaacacatcaagcacaagtatgagaacaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FXYD domain containing ion transport regulator 3 - high-mobility group nucleosomal binding domain 2 - FXYD domain containing ion transport regulator 6 - P antigen family, member 4 (prostate associated) |