UCRC-ubiquinol-cytochrome c reductase complex (7.2 kD) Gene View larger

UCRC-ubiquinol-cytochrome c reductase complex (7.2 kD) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UCRC-ubiquinol-cytochrome c reductase complex (7.2 kD) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UCRC-ubiquinol-cytochrome c reductase complex (7.2 kD) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005402
Product type: DNA & cDNA
Ncbi symbol: UCRC
Origin species: Human
Product name: UCRC-ubiquinol-cytochrome c reductase complex (7.2 kD) Gene
Size: 2ug
Accessions: BC005402
Gene id: 29796
Gene description: ubiquinol-cytochrome c reductase complex (7.2 kD)
Synonyms: UCRC; HSPC051; HSPC119; HSPC151; QCR9; UCCR7.2; cytochrome b-c1 complex subunit 9; cytochrome C1, nonheme 7kDa protein; cytochrome c1 non-heme 7 kDa protein; ubiquinol-cytochrome c reductase complex (7.2 kD); ubiquinol-cytochrome c reductase complex 7.2 kDa protein; ubiquinol-cytochrome c reductase, complex III subunit X, 7.2kDa; ubiquinol-cytochrome c reductase, complex III subunit X
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccgcgacgttgacttcgaagttgtactccctgctgttccgcaggacctccaccttcgccctcaccatcatcgtgggcgtcatgttcttcgagcgcgccttcgatcaaggcgcggacgctatctacgaccacatcaacgaggggaagctgtggaaacacatcaagcacaagtatgagaacaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FXYD domain containing ion transport regulator 3
- high-mobility group nucleosomal binding domain 2
- FXYD domain containing ion transport regulator 6
- P antigen family, member 4 (prostate associated)

Buy UCRC-ubiquinol-cytochrome c reductase complex (7.2 kD) Gene now

Add to cart