Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FXYD3-FXYD domain containing ion transport regulator 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FXYD3-FXYD domain containing ion transport regulator 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005238 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FXYD3 |
| Origin species: | Human |
| Product name: | FXYD3-FXYD domain containing ion transport regulator 3 Gene |
| Size: | 2ug |
| Accessions: | BC005238 |
| Gene id: | 5349 |
| Gene description: | FXYD domain containing ion transport regulator 3 |
| Synonyms: | MAT8; PLML; FXYD domain-containing ion transport regulator 3; chloride conductance inducer protein Mat-8; mammary tumor 8 kDa protein; phospholemman-like protein; FXYD domain containing ion transport regulator 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagaaggtgaccctgggcctgcttgtgttcctggcaggctttcctgtcctggacgccaatgacctagaagataaaaacagtcctttctactatgactggcacagcctccaggttggcgggctcatctgcgctggggttctgtgcgccatgggcatcatcatcgtcatgagtgcaaaatgcaaatgcaagtttggccagaagtccggtcaccatccaggggagactccacctctcatcaccccaggctcagcccaaagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - high-mobility group nucleosomal binding domain 2 - FXYD domain containing ion transport regulator 6 - P antigen family, member 4 (prostate associated) - ubiquinol-cytochrome c reductase binding protein |