FXYD3-FXYD domain containing ion transport regulator 3 Gene View larger

FXYD3-FXYD domain containing ion transport regulator 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FXYD3-FXYD domain containing ion transport regulator 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FXYD3-FXYD domain containing ion transport regulator 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005238
Product type: DNA & cDNA
Ncbi symbol: FXYD3
Origin species: Human
Product name: FXYD3-FXYD domain containing ion transport regulator 3 Gene
Size: 2ug
Accessions: BC005238
Gene id: 5349
Gene description: FXYD domain containing ion transport regulator 3
Synonyms: MAT8; PLML; FXYD domain-containing ion transport regulator 3; chloride conductance inducer protein Mat-8; mammary tumor 8 kDa protein; phospholemman-like protein; FXYD domain containing ion transport regulator 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagaaggtgaccctgggcctgcttgtgttcctggcaggctttcctgtcctggacgccaatgacctagaagataaaaacagtcctttctactatgactggcacagcctccaggttggcgggctcatctgcgctggggttctgtgcgccatgggcatcatcatcgtcatgagtgcaaaatgcaaatgcaagtttggccagaagtccggtcaccatccaggggagactccacctctcatcaccccaggctcagcccaaagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - high-mobility group nucleosomal binding domain 2
- FXYD domain containing ion transport regulator 6
- P antigen family, member 4 (prostate associated)
- ubiquinol-cytochrome c reductase binding protein

Buy FXYD3-FXYD domain containing ion transport regulator 3 Gene now

Add to cart