EEF1G-eukaryotic translation elongation factor 1 gamma Gene View larger

EEF1G-eukaryotic translation elongation factor 1 gamma Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EEF1G-eukaryotic translation elongation factor 1 gamma Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EEF1G-eukaryotic translation elongation factor 1 gamma Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000384
Product type: DNA & cDNA
Ncbi symbol: EEF1G
Origin species: Human
Product name: EEF1G-eukaryotic translation elongation factor 1 gamma Gene
Size: 2ug
Accessions: BC000384
Gene id: 1937
Gene description: eukaryotic translation elongation factor 1 gamma
Synonyms: EF1G; GIG35; elongation factor 1-gamma; EF-1-gamma; PRO1608; eEF-1B gamma; pancreatic tumor-related protein; translation elongation factor eEF-1 gamma chain; eukaryotic translation elongation factor 1 gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctgggaccctgtacacgtatcctgaaaactggagggccttcaaggctctcatcgctgctcagtacagcggggctcaggtccgcgtgctctccgcaccaccccacttccattttggccaaaccaaccgcacccctgaatttctccgcaaatttcctgccggcaaggtcccagcatttgagggtgatgatggattctgtgtgtttgagagcaacgccattgcctactatgtgagcaatgaggagctgcggggaagtactccagaggcagcagcccaggtggtgcagtgggtgagctttgctgattccgatatagtgcccccagccagtacctgggtgttccccaccttgggcatcatgcaccacaacaaacaggccactgagaatgcaaaggaggaagtgaggcgaattctggggctgctggatgcttacttgaagacgaggacttttctggtgggcgaacgagtgacattggctgacatcacagttgtctgcaccctgttgtggctctataagcaggttctagagccttctttccgccaggcctttcccaataccaaccgctggttcctcacctgcattaaccagccccagttccgggctgtcttgggcgaagtgaaactgtgtgagaagatggcccagtttgatgctaaaaagtttgcagagacccaacctaaaaaggacacaccacggaaagagaagggttcacgggaagagaagcagaagccccaggctgagcggaaggaggagaaaaaggcggctgcccctgctcctgaggaggagatggatgaatgtgagcaggcgctggctgctgagcccaaggccaaggaccccttcgctcacctgcccaagagtacctttgtgttggatgaatttaagcgcaagtactccaatgaggacacactctctgtggcactgccatatttctgggagcactttgataaggacggctggtccctgtggtactcagagtatcgcttccctgaagaactcactcagaccttcatgagctgcaatctcatcactggaatgttccagcgactggacaagctgaggaagaatgccttcgccagtgtcatcctttttggaaccaacaatagcagctccatttctggagtctgggtcttccgaggccaggagcttgcctttccgctgagtccagattggcaggtggactacgagtcatacacatggcggaaactggatcctggcagcgaggagacccagacgctggttcgagagtacttttcctgggagggggccttccagcatgtgggcaaagccttcaatcagggcaagatcttcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fragile X mental retardation, autosomal homolog 2
- transcription factor 25 (basic helix-loop-helix)
- ubiquinol-cytochrome c reductase complex (7.2 kD)
- FXYD domain containing ion transport regulator 3

Buy EEF1G-eukaryotic translation elongation factor 1 gamma Gene now

Add to cart