M6PRBP1-mannose-6-phosphate receptor binding protein 1 Gene View larger

M6PRBP1-mannose-6-phosphate receptor binding protein 1 Gene

PTXBC005818

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of M6PRBP1-mannose-6-phosphate receptor binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about M6PRBP1-mannose-6-phosphate receptor binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005818
Product type: DNA & cDNA
Ncbi symbol: M6PRBP1
Origin species: Human
Product name: M6PRBP1-mannose-6-phosphate receptor binding protein 1 Gene
Size: 2ug
Accessions: BC005818
Gene id: 10226
Gene description: mannose-6-phosphate receptor binding protein 1
Synonyms: M6PRBP1; PP17; perilipin-3; 47 kDa MPR-binding protein; cargo selection protein TIP47; mannose-6-phosphate receptor-binding protein 1; placental protein 17; tail-interacting protein, 47 kD; testicular tissue protein Li 114; perilipin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgccgacggggcagaggctgatggcagcacccaggtgacagtggaagaaccggtacagcagcccagtgtggtggaccgtgtggccagcatgcctctgatcagctccacctgcgacatggtgtccgcagcctatgcctccaccaaggagagctacccgcacatcaagactgtctgcgacgcagcagagaagggagtgaggaccctcacggcggctgctgtcagcggggctcagccgatcctctccaagctggagccccagattgcatcagccagcgaatacgcccacagggggctggacaagttggaggagaacctccccatcctgcagcagcccacggagaaggtcctggcggacaccaaggagcttgtgtcgtctaaggtgtcgggggcccaagagatggtgtctagcgccaaggacacggtggccacccaattgtcggaggcggtggacgcgacccgcggtgctgtgcagagcggcgtggacaagacaaagtccgtagtgaccggcggcgtccaatcagtcatgggctcccgcttgggccagatggtgctgagtggggtcgacacggtgctggggaagtcggaggagtgggcggacaaccacctgccccttacggatgccgaactggcccgcatcgccacatccctggatggcttcgacgtcgcgtccgtgcagcagcagcggcaggaacagagctacttcgtacgtctgggctccctgtcggagaggctgcggcagcacgcctatgagcactcgctgggcaagcttcgagccaccaagcagagggcacaggaggctctgctgcagctgtcgcaggccctaagcctgatggaaactgtcaagcaaggcgttgatcagaagctggtggaaggccaggagaagctgcaccagatgtggctcagctggaaccagaagcagctccagggccccgagaaggagccgcccaagccagagcaggtcgagtcccgggcgctcaccatgttccgggacattgcccagcaactgcaggccacctgtacctccctggggtccagcattcagggcctccccaccaatgtgaaggaccaggtgcagcaggcccgccgccaggtggaggacctccaggccacgttttccagcatccactccttccaggacctgtccagcagcattctggcccagagccgtgagcgtgtcgccagcgcccgcgaggccctggaccacatggtggaatatgtggcccagaacacacctgtcacgtggctcgtgggaccctttgcccctggaatcactgagaaagccccggaggagaagaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation elongation factor 1 gamma
- eukaryotic translation elongation factor 1 gamma
- eukaryotic translation elongation factor 1 gamma
- fragile X mental retardation, autosomal homolog 2

Buy M6PRBP1-mannose-6-phosphate receptor binding protein 1 Gene now

Add to cart