BCAT2-branched chain aminotransferase 2, mitochondrial Gene View larger

BCAT2-branched chain aminotransferase 2, mitochondrial Gene

PTXBC001900

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BCAT2-branched chain aminotransferase 2, mitochondrial Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BCAT2-branched chain aminotransferase 2, mitochondrial Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001900
Product type: DNA & cDNA
Ncbi symbol: BCAT2
Origin species: Human
Product name: BCAT2-branched chain aminotransferase 2, mitochondrial Gene
Size: 2ug
Accessions: BC001900
Gene id: 587
Gene description: branched chain aminotransferase 2, mitochondrial
Synonyms: BCAM; BCATM; BCT2; PP18; branched-chain-amino-acid aminotransferase, mitochondrial; branched chain amino-acid transaminase 2, mitochondrial; branched chain aminotransferase 2, mitochondrial; placental protein 18; branched chain amino acid transaminase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcagccgctctggggcagatctgggcacgaaagcttctctctgtcccttggcttctgtgtggtcccagaagatatgcctcctccagtttcaaggctgcagacctgcagctggaaatgacacagaagcctcataagaagcctggccccggcgagcccctggtgtttgggaagacatttaccgaccacatgctgatggtggaatggaatgacaagggctggggccagccccgaatccagcccttccagaacctcacgctgcacccagcctcctccagcctccactactccctgcagctgtttgagggcatgaaggcgttcaaaggcaaagaccagcaggtgcgcctcttccgcccctggctcaacatggaccggatgctgcgctcagccatgcgcctgtgcctgccgagtttcgacaagctggagttgctggagtgcatccgccggctcatcgaagtggacaaggactgggtccccgatgccgccggcaccagcctctatgtgcggcctgtgctcattgggaacgagccctcgctgggtgtcagccagcccacgcgcgcgctcctgttcgtcattctctgcccagtgggtgcctacttccctggaggctccgtgaccccggtctccctcctggccgacccagccttcatccgggcctgggtgggcggggtcggcaactacaagttaggtgggaattatgggcccaccgtgttagtgcaacaggaggcactcaagcggggctgtgaacaggtcctctggctgtatgggcccgaccaccagctcaccgaggtgggaaccatgaacatctttgtctactggacccacgaagatggggtgctggagctggtgacgcccccgctgaatggtgttatcctgcctggagtggtcagacagagtctactggacatggctcagacctggggtgagttccgggtggtggagcgcacgatcaccatgaagcagttgctgcgggccctggaggagggccgcgtgcgggaagtctttggctcgggcaccgcttgccaggtctgcccagtgcaccgaatcctgtacaaagacaggaacctccacattcccaccatggaaaatgggcctgagctgatcctccgcttccagaaggagctgaaggagatccagtacggaatcagagcccacgagtggatgttcccggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coagulation factor II (thrombin) receptor-like 1
- mannose-6-phosphate receptor binding protein 1
- eukaryotic translation elongation factor 1 gamma
- eukaryotic translation elongation factor 1 gamma

Buy BCAT2-branched chain aminotransferase 2, mitochondrial Gene now

Add to cart