CDC42EP4-CDC42 effector protein (Rho GTPase binding) 4 Gene View larger

CDC42EP4-CDC42 effector protein (Rho GTPase binding) 4 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDC42EP4-CDC42 effector protein (Rho GTPase binding) 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDC42EP4-CDC42 effector protein (Rho GTPase binding) 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010451
Product type: DNA & cDNA
Ncbi symbol: CDC42EP4
Origin species: Human
Product name: CDC42EP4-CDC42 effector protein (Rho GTPase binding) 4 Gene
Size: 2ug
Accessions: BC010451
Gene id: 23580
Gene description: CDC42 effector protein (Rho GTPase binding) 4
Synonyms: BORG4; CEP4; KAIA1777; cdc42 effector protein 4; CDC42 effector protein (Rho GTPase binding) 4; binder of Rho GTPases 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctaatcctcaagcaactggtgtccagctcggtgcactccaagcgccgttcccgagcggacctcacggccgagatgatcagcgccccgctgggcgacttccgccacaccatgcacgttggccgggccggagacgcctttggggacacctccttcctcaatagcaaggctggcgagcccgacggcgagtccttggacgaacagccctcttcttcatcttccaaacgcagtctcctgtccaggaagttccggggcagcaagcggtcacagtcggtgaccaggggggagcgggagcagcgtgacatgctgggctccctgcgggactcggccctgtttgtcaagaatgccatgtccctgccccagctcaatgagaaggaggccgcggagaagggcaccagtaagctgcccaagagcctgtcatccagccccgtgaagaaggccaatgacggggagggcggcgatgaggaggcgggcacggaggaggcagtgccccgtcggaatggggccgcgggtccacattcccctgaccccctcctcgatgagcaggcctttggggatctgacagatctgcctgtcgtgcccaaggccacgtacgggctgaagcatgcggagtccatcatgtccttccacatcgacctggggccctccatgctgggtgacgtcctcagcatcatggacaaggaggagtgggaccccgaggagggggagggtggttaccatggcgatgagggcgccgctggcaccatcacccaggctcccccgtacgccgtggcggcccctcccctggcaaggcaggaaggcaaggctggcccagacttgccctccctcccctcccatgctctggaggatgaggggtgggcagcagcggcccccagccccggctcagcccgcagcatgggcagccacaccacacgggacagcagctccctctccagctgcacctcaggcatcctggaggagcgcagccctgccttccgggggccggacagggcccgggctgctgtctcaagacagccagacaaggagttctccttcatggatgaggaggaggaggatgaaatccgtgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - branched chain aminotransferase 2, mitochondrial
- coagulation factor II (thrombin) receptor-like 1
- mannose-6-phosphate receptor binding protein 1
- eukaryotic translation elongation factor 1 gamma

Buy CDC42EP4-CDC42 effector protein (Rho GTPase binding) 4 Gene now

Add to cart