Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RALGPS1-Ral GEF with PH domain and SH3 binding motif 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RALGPS1-Ral GEF with PH domain and SH3 binding motif 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032372 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RALGPS1 |
| Origin species: | Human |
| Product name: | RALGPS1-Ral GEF with PH domain and SH3 binding motif 1 Gene |
| Size: | 2ug |
| Accessions: | BC032372 |
| Gene id: | 9649 |
| Gene description: | Ral GEF with PH domain and SH3 binding motif 1 |
| Synonyms: | ralA exchange factor RalGPS1; ras-specific guanine nucleotide-releasing factor RalGPS1; RALGEF2; RALGPS1A; Ral guanine nucleotide exchange factor RalGPS1A; RalGEF 2; ral GEF with PH domain and SH3-binding motif 1; ral guanine nucleotide exchange factor 2; Ral GEF with PH domain and SH3 binding motif 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtacaagaggaatggtctgatggctagcgtgttggtcacctctgccactccacagggcagcagcagctcggactctctggagggccagagctgcgactatgccagcaagagctatgatgccgttgtcttcgatgtcttgaaagtgaccccagaggagtttgctagccagattacattaatggatatacctgtgtttaaagctatccagccggaggaactagccagctgtggatggagtaagaaggagaaacacactcttgcccctaacgttgtggcctttacccggaggtttaaccaggtcagtttttgggttgtacgagaaattctaacagcacagactttaaaaataagggcagaaatcctcagccattttgtgaaaatagccaagaaacttctagaactcaacaaccttcattctctcatgtctgtggtatcagcattacaaagtgctcccatcttcaggctgacaaaaacctgggctcttttaaatcgaaaagacaagactacctttgagaaattggactacctgatgtcgaaagaagataattacaagcggacacgggaatatatccgaagcctgaagatggttccaagtattccctatctaggaatctatcttctggatttaatctacattgattctgcatatcctgcctcaggcagtatcatggaaaatgaacaaagatccaatcagatgaacaatattcttcgaataattgctgatttacaagtttcctgcagctatgatcacctcaccaccctgccccatgtgcagaagtacctgaagtccgtacgctacattgaagagctccagaagtttgtggaagacgacaactacaaactgtcgctcagaatcgaaccaggaagcagctctccaagactagtctcttccaaggaagatcttgcagccatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fibronectin type III and SPRY domain containing 1 - CDC42 effector protein (Rho GTPase binding) 4 - branched chain aminotransferase 2, mitochondrial - coagulation factor II (thrombin) receptor-like 1 |