MGC34761-hypothetical protein MGC34761 Gene View larger

MGC34761-hypothetical protein MGC34761 Gene

PTXBC039068

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC34761-hypothetical protein MGC34761 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC34761-hypothetical protein MGC34761 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039068
Product type: DNA & cDNA
Ncbi symbol: MGC34761
Origin species: Human
Product name: MGC34761-hypothetical protein MGC34761 Gene
Size: 2ug
Accessions: BC039068
Gene id: 283971
Gene description: hypothetical protein MGC34761
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccggagccctgaacaggaaggagagtttcttgctcctctccctgcacaaccgcctgcgcagctgggtccagccccctgcggctgacaggcggaggctggactggagtgacagcctggcccaactggctcaagccagggcagccctctgtggaatcccaaccccgagcctggcgtccggcctgtggcgcaccctgcaagtgggctggaacatgcagctgctgcccgcgggcttggcgtcctttgttgaagtggtcagcctatggtttgcagaggggcagcggtacagccacgcggcaggagagtgtgctcgcaacgccacctgcacccactacacgcagctcgtgtgggccacctcaagccagctgggctgtgggcggcacctgtgctctgcaggccaggcagcgatagaagcctttgtctgtgcctactcccccagaggcaactgggaggtcaacgggaagacaatcgtcccctataagaagggtgcctggtgttcgctctgcacagccagtgtctcaggctgcttcaaagcctgggaccatgcaggggggctctgtgaggtccccaggaatccttgtcgcatgagctgccagaaccatggacgtctcaacatcagcacctgccactgccactgtccccctggctacacgggcagatactgccaagtgaggtgcagcctgcagtgtgtgcacggccggttccgggaggaggagtgctcgtgcgtctgtgacatcggctacgggggagcccagtgtgccaccaaggtgcattttcccttccacacctgtgacctgaggatcgacggagactgcttcatggtgtcttcagaggcagacacctattacagagccaggatgaaatgtcaggtgacagtcacccctagcttcctaggaaccccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peroxisomal biogenesis factor 10
- peroxisomal biogenesis factor 10
- SUMO1 activating enzyme subunit 1
- alpha 1,4-galactosyltransferase

Buy MGC34761-hypothetical protein MGC34761 Gene now

Add to cart