Login to display prices
Login to display prices
PEX10-peroxisomal biogenesis factor 10 Gene View larger

PEX10-peroxisomal biogenesis factor 10 Gene

PTXBC018198

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEX10-peroxisomal biogenesis factor 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PEX10-peroxisomal biogenesis factor 10 Gene

Proteogenix catalog: PTXBC018198
Ncbi symbol: PEX10
Product name: PEX10-peroxisomal biogenesis factor 10 Gene
Size: 2ug
Accessions: BC018198
Gene id: 5192
Gene description: peroxisomal biogenesis factor 10
Synonyms: NALD; PBD6A; PBD6B; RNF69; peroxisome biogenesis factor 10; RING finger protein 69; peroxin 10; peroxisome assembly protein 10; peroxisomal biogenesis factor 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccccggccgccgccagccccccggaggtgatccgcgcggcgcagaaggacgagtactaccgcggtgggctgcggagcgcggcgggcggcgccctgcacagcctggcgggtgcgaggaagtggctggagtggaggaaggaggttgagctgctctcagatgtggcctactttggcctcaccacacttgcaggctaccagaccctgggggaggagtacgtcagcatcatccaggtggacccatcgcggatacatgtgccctcctcgctgcgccgtggcgtgctggtgacactgcatgccgtcctgccctacctgctggacaaggccctgctccccctggagcaggagctgcaggctgaccccgacagtgggcgacccttgcaggggagcctggggccaggtgggcgtggctgctcaggggcgcggcgctggatgcgtcaccacacggccaccctgactgagcagcagaggagggcgctgctgcgggcggtcttcgtcctcagacagggcctcgcctgcctccagcggctacatgttgcctggttttacatccacggtgtcttctaccacctggccaagaggctcacggggatcacgtacctccgtgtccgcagcctgcccggagaggacctgagggcccgtgttagctacaggctgctgggggtcatctcactgctgcacctggtgctgtccatggggctgcagctgtacggtttcaggcagcggcagcgagccaggaaggagtggaggctgcaccgcggcctgtctcaccgcagggcctccttggaggagagagccgtttccagaaaccccctgtgcaccctgtgcctggaggagcgcaggcacccaacagccacgccctgcggccacctgttctgctgggagtgcatcaccgcgtggtgcagcagcaaggcggagtgtcccctctgccgggagaagttccctccccagaagctcatctaccttcggcactaccgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: