Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SAE1-SUMO1 activating enzyme subunit 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SAE1-SUMO1 activating enzyme subunit 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000344 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SAE1 |
| Origin species: | Human |
| Product name: | SAE1-SUMO1 activating enzyme subunit 1 Gene |
| Size: | 2ug |
| Accessions: | BC000344 |
| Gene id: | 10055 |
| Gene description: | SUMO1 activating enzyme subunit 1 |
| Synonyms: | AOS1; HSPC140; SUA1; UBLE1A; SUMO-activating enzyme subunit 1; SUMO-1 activating enzyme E1 N subunit; SUMO-1 activating enzyme subunit 1; activator of SUMO1; sentrin/SUMO-activating protein AOS1; ubiquitin-like 1-activating enzyme E1A; ubiquitin-like protein SUMO-1 activating enzyme; SUMO1 activating enzyme subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggagaaggaggaggctggcggcggcattagcgaggaggaggcggcacagtatgaccggcagatccgcctgtggggactggaggcccagaaacggctgcgggcctctcgggtgcttcttgtcggcttgaaaggacttggggctgaaattgccaagaatctcatcttggcaggagtgaaaggactgaccatgctggatcacgaacaggtaactccagaagatcccggagctcagttcttgattcgtactgggtctgttggccgaaatagggctgaagcctctttggagcgagctcagaatctcaaccccatggtggatgtgaaggtggacactgaggatatagagaagaaaccagagtcatttttcactcaattcgatgctgtgtgtctgacttgctgctccagggatgtcatagttaaagttgaccagatctgtcacaaaaatagcatcaagttctttacaggagatgtttttggctaccatggatacacatttgccaatctaggagagcatgagtttgtagaggagaaaactaaagttgccaaagttagccaaggagtagaagatgggcccgacaccaagagagcaaaacttgattcttctgagacaacgatggtcaaaaagaaggtggtcttctgccctgttaaagaagccctggaggtggactggagcagtgagaaagcaaaggctgctctgaagcgcacgacctccgactactttctccttcaagtgctcttaaagttccgtacagataaaggaagagatcccagttctgatacatatgaggaagattctgagttgttgctccagatacgaaatgatgtgcttgactcactgggtattagtcctgacctgcttcctgaggactttgtcaggtactgcttctccgagatggccccagtgtgtgcggtggttggagggattttggcacaggaaattgtgaaggccctgtctcagcgggaccctcctcacaacaacttcttcttcttcgatggcatgaaggggaatgggattgtggagtgccttggccccaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - alpha 1,4-galactosyltransferase - phosphoserine aminotransferase 1 - delta-like 1 homolog (Drosophila) - tetratricopeptide repeat domain 4 |