DLK1-delta-like 1 homolog (Drosophila) Gene View larger

DLK1-delta-like 1 homolog (Drosophila) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DLK1-delta-like 1 homolog (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DLK1-delta-like 1 homolog (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007741
Product type: DNA & cDNA
Ncbi symbol: DLK1
Origin species: Human
Product name: DLK1-delta-like 1 homolog (Drosophila) Gene
Size: 2ug
Accessions: BC007741
Gene id: 8788
Gene description: delta-like 1 homolog (Drosophila)
Synonyms: DLK; DLK-1; Delta1; FA1; PREF1; Pref-1; ZOG; pG2; protein delta homolog 1; delta-like 1 homolog; fetal antigen 1; preadipocyte factor 1; secredeltin; delta like non-canonical Notch ligand 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgcgaccgaagccctcctgcgcgtcctcttgctcctgctggctttcggccacagcacctatggggctgaatgcttcccggcctgcaacccccaaaatggattctgcgaggatgacaatgtttgcaggtgccagcctggctggcagggtcccctttgtgaccagtgcgtgacctctcccggctgccttcacggactctgtggagaacccgggcagtgcatttgcaccgacggctgggacggggagctctgtgatagagatgttcgggcctgctcctcggccccctgtgccaacaacgggacctgcgtgagcctggacgatggcctctatgaatgctcctgtgcccccgggtactcgggaaaggactgccagaaaaaggacgggccctgtgtgatcaacggctccccctgccagcacggaggcacctgcgtggatgatgagggccgggcctcccatgcctcctgcctgtgcccccctggcttctcaggcaatttctgcgagatcgtggccaacagctgcacccccaacccatgcgagaacgacggcgtctgcactgacatcgggggcgacttccgctgccggtgcccagccggcttcatcgacaagacctgcagccgcccggtgaccaactgcgccagcagcccgtgccagaacgggggcacctgcctgcagcacacccaggtgagctacgagtgtctgtgcaagcccgagttcacaggtctcacctgtgtcaagaagcgcgcgctgagcccccagcaggtcacccgtctgcccaacggctatgggctggcctaccgcctgacccctggggtgcacgagctgccggtgcagcagccggagcaccgcatcctgaaggtgtccatgaaagagctcaacaagaaaacccctctcctcaccgagggccaggccatctgcttcaccatcctgggcgtgctcaccagcctggtggtgctgggcactgtgggtatcgtcttcctcaacaagtgcgagacctgggtgtccaacctgcgctacaaccacatgctgcggaagaagaagaacctgctgcttcagtacaacagcggggaggacctggccgtcaacatcatcttccccgagaagatcgacatgaccaccttcagcaaggaggccggcgacgaggagatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetratricopeptide repeat domain 4
- SERPINE1 mRNA binding protein 1
- calcium activated nucleotidase 1
- SERPINE1 mRNA binding protein 1

Buy DLK1-delta-like 1 homolog (Drosophila) Gene now

Add to cart