Login to display prices
Login to display prices
A4GALT-alpha 1,4-galactosyltransferase Gene View larger

A4GALT-alpha 1,4-galactosyltransferase Gene

PTXBC017068

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of A4GALT-alpha 1,4-galactosyltransferase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about A4GALT-alpha 1,4-galactosyltransferase Gene

Proteogenix catalog: PTXBC017068
Ncbi symbol: A4GALT
Product name: A4GALT-alpha 1,4-galactosyltransferase Gene
Size: 2ug
Accessions: BC017068
Gene id: 53947
Gene description: alpha 1,4-galactosyltransferase
Synonyms: A14GALT; A4GALT1; Gb3S; P1PK; lactosylceramide 4-alpha-galactosyltransferase; GB3 synthase; P blood group (P one antigen); P(k) antigen synthase; P1/Pk synthase; UDP-galactose:beta-D-galactosyl-beta1-R 4-alpha-D-galactosyltransferase; alpha 14-galactosyltransferase; alpha-1,4-N-acetylglucosaminyltransferase; alpha4Gal-T1; globotriaosylceramide synthase; truncated alpha 1,4-galactosyltransferase; alpha 1,4-galactosyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccaagccccccgacctcctgctgcggctgctccggggcgccccaaggcagcgggtctgcaccctgttcatcatcggcttcaagttcacgtttttcgtctccatcatgatctactggcacgttgtgggagagcccaaggagaaagggcagctctataacctgccagcagagatcccctgccccaccttgacaccccccaccccaccctcccacggccccactccaggcaacatcttcttcctggagacttcagaccggaccaaccccaacttcctgttcatgtgctcggtggagtcggccgccagaactcaccccgaatcccacgtgctggtcctgatgaaagggcttccgggtggcaacgcctctctgccccggcacctgggcatctcacttctgagctgcttcccgaatgtccagatgctcccgctggacctgcgggagctgttccgggacacacccctggccgactggtacgcggccgtgcaggggcgctgggagccctacctgctgcccgtgctctccgacgcctccaggatcgcactcatgtggaagttcggcggcatctacctggacacggacttcattgttctcaagaacctgcggaacctgaccaacgtgctgggcacccagtcccgctacgtcctcaacggcgcgttcctggccttcgagcgccggcacgagttcatggcgctgtgcatgcgggacttcgtggaccactacaacggctggatctggggtcaccagggcccgcagctgctcacgcgggtcttcaagaagtggtgttccatccgcagcctggccgagagccgcgcctgccgcggcgtcaccaccctgccccctgaggccttctaccccatcccctggcaggactggaagaagtactttgaggacatcaaccccgaggagctgccgcggctgctcagtgccacctatgctgtccacgtgtggaacaagaagagccagggcacgcggttcgaggccacgtccagggcactgctggcccagctgcatgcccgctactgccccacgacgcacgaggccatgaaaatgtacttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: