PEX10-peroxisomal biogenesis factor 10 Gene View larger

PEX10-peroxisomal biogenesis factor 10 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEX10-peroxisomal biogenesis factor 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PEX10-peroxisomal biogenesis factor 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000543
Product type: DNA & cDNA
Ncbi symbol: PEX10
Origin species: Human
Product name: PEX10-peroxisomal biogenesis factor 10 Gene
Size: 2ug
Accessions: BC000543
Gene id: 5192
Gene description: peroxisomal biogenesis factor 10
Synonyms: NALD; PBD6A; PBD6B; RNF69; peroxisome biogenesis factor 10; RING finger protein 69; peroxin 10; peroxisome assembly protein 10; peroxisomal biogenesis factor 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccccggccgccgccagccccccggaggtgatccgcgcggcgcagaaggacgagtactaccgcggtgggctgcggagcgcggcgggcggcgccctgcacagcctggcgggtgcgaggaagtggctggagtggaggaaggaggttgagctgctctcagatgtggcctactttggcctcaccacacttgcaggctaccagaccctgggggaggagtacgtcagcatcatccaggtggacccatcgcggatacatgtgccctcctcgctgcgccgtggcgtgctggtgacgctgcatgccgtcctgccctacctgctggacaaggccctgctccccctggagcaggagctgcaggctgaccccgacagtgggcgacccttgcaggggagcctggggccaggtgggcgtggctgctcaggggcgcggcgctggatgcgtcaccacacggccaccctgactgagcagcagaggagggcgctgctgcgggcggtcttcgtcctcagacagggcctcgcctgcctccagcggctacatgttgcctggttttacatccacggtgtcttctaccacctggccaagaggctcacggggatcacgtaccaggcgctgaggccagatcccctcagggtcctgatgagtgtggcgccatctgccttacagctccgtgtccgcagcctgcccggagaggacctgagggcccgtgttagctacaggctgctgggggtcatctcactgctgcacctggtgctgtccatggggctgcagctgtacggtttcaggcagcggcagcgagccaggaaggagtggaggctgcaccgcggcctgtctcaccgcagggcctccttggaggagagagccgtttccagaaaccccctgtgcaccctgtgcctggaggagcgcaggcacccaacagccacgccctgcggccacctgttctgctgggagtgcatcaccgcgtggtgcagcagcaaggcggagtgtcccctctgccgggagaagttccctccccagaagctcatctaccttcggcactaccgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SUMO1 activating enzyme subunit 1
- alpha 1,4-galactosyltransferase
- phosphoserine aminotransferase 1
- delta-like 1 homolog (Drosophila)

Buy PEX10-peroxisomal biogenesis factor 10 Gene now

Add to cart