MR1-major histocompatibility complex, class I-related Gene View larger

MR1-major histocompatibility complex, class I-related Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MR1-major histocompatibility complex, class I-related Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MR1-major histocompatibility complex, class I-related Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012485
Product type: DNA & cDNA
Ncbi symbol: MR1
Origin species: Human
Product name: MR1-major histocompatibility complex, class I-related Gene
Size: 2ug
Accessions: BC012485
Gene id: 3140
Gene description: major histocompatibility complex, class I-related
Synonyms: HLALS; major histocompatibility complex class I-related gene protein; MHC class I-like antigen MR-1; MHC class-I related-gene protein; major histocompatibility complex, class I-like sequence; major histocompatibility complex, class I-related
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggaactgatggcgttcctgttacctctcatcattgtgttaatggtgaagcacagcgattcccggacgcactctctgagatattttcgcctgggcgtttcggatcccatccatggggtccctgaatttatttcggttgggtacgtggactcgcaccctatcaccacatatgacagtgtcactcggcagaaggagccacgggccccatggatggcagagaacctcgcgcctgatcactgggagaggtacactcagctgctgaggggctggcagcagatgttcaaggtggaactgaagcgcctacagaggcactacaatcactcagataatgtggctcacaccatcaagcaggcatgggaggccaatcagcatgagttgctgtatcaaaagaattggctggaagaagaatgtattgcctggctaaagagattcctggagtatgggaaagacaccctacaaagaacagagcccccactggtcagagtaaatcgcaaagaaacttttccaggggttacagctctcttctgcaaagctcatggcttttaccccccagaaatttacatgacatggatgaaaaacggggaagaaattgtccaagaaattgattatggagacattcttcccagtggggatggaacctatcaggcgtgggcatcaattgagcttgatcctcagagcagcaacctttactcctgtcatgtggagcactgcggtgtccacatggttcttcaggtcccccaggaatcagaaactatccctcttgtgatgaaagctgtctctgggtccattgtccttgtcattgtgctggctggagttggtgttctagtctggagaagaaggccccgagagcaaaatggagccatctaccttccaacaccagatcgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - poly (ADP-ribose) polymerase family, member 11
- family with sequence similarity 118, member B
- minichromosome maintenance complex component 10
- family with sequence similarity 105, member A

Buy MR1-major histocompatibility complex, class I-related Gene now

Add to cart