FAM105A-family with sequence similarity 105, member A Gene View larger

FAM105A-family with sequence similarity 105, member A Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM105A-family with sequence similarity 105, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM105A-family with sequence similarity 105, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011524
Product type: DNA & cDNA
Ncbi symbol: FAM105A
Origin species: Human
Product name: FAM105A-family with sequence similarity 105, member A Gene
Size: 2ug
Accessions: BC011524
Gene id: 54491
Gene description: family with sequence similarity 105, member A
Synonyms: protein FAM105A; inactive ubiquitin thioesterase FAM105A; NET20; family with sequence similarity 105 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgacaaggagccccacgcgggcaagggagcgggagcggtctggcgctcccgccgcaggaagtgaccaagttcactcctggatgctagctacaagccaagccttagacactgtctggagaatggcaaaaggctttgtgatgttggcagtttcatttctggtggctgccatctgctacttccggaggctacatttatattcagggcacaagctgaaatggtggattggatatctgcagagaaaattcaaaaggaacctcagtgtggaggcagaggttgatttactcagttattgtgcaagagaatggaaaggagagacaccccgtaacaagctgatgaggaaggcttatgaggagctattttggcggcatcacattaaatgtgttcgacaagtaaggagagataactatgatgctctcagatcagtgttatttcagatattcagccagggcatctcttttccatcatggatgaaagaaaaggacattgttaagcttcctgaaaaactgctgttttcacaaggttgtaattggattcagcagtacagttttggtcctgagaagtatacaggctcgaatgtgtttggaaaactacggaaatatgtggaattattgaaaacacagtggactgaatttaatggcattagagattatcacaagagaggaagtatgtgcaacacccttttttcagatgccattctggaatataaactttatgaagctttaaagttcatcatgctgtatcaagtcactgaagtttatgaacaaatgaagactaaaaaggtcattcccagtctttttagactcctgttttccagggagacatcctctgatcctttgagcttcatgatgaatcacctgaattctgtaggcgacacatgtggactagagcagattgatatgtttatacttggatactcccttgaagtaaagataaaagtgttcagactgttcaagtttaactccagagactttgaagtctgctacccagaggagcctctcagggactggccggagatctccctgctgaccgagaacgaccgccactaccacattccagtcttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chitinase 3-like 1 (cartilage glycoprotein-39)
- REX4, RNA exonuclease 4 homolog (S. cerevisiae)
- adaptor-related protein complex 1, mu 2 subunit
- adaptor-related protein complex 1, mu 2 subunit

Buy FAM105A-family with sequence similarity 105, member A Gene now

Add to cart