Login to display prices
Login to display prices
AP1M2-adaptor-related protein complex 1, mu 2 subunit Gene View larger

AP1M2-adaptor-related protein complex 1, mu 2 subunit Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AP1M2-adaptor-related protein complex 1, mu 2 subunit Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AP1M2-adaptor-related protein complex 1, mu 2 subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003387
Product type: DNA & cDNA
Ncbi symbol: AP1M2
Origin species: Human
Product name: AP1M2-adaptor-related protein complex 1, mu 2 subunit Gene
Size: 2ug
Accessions: BC003387
Gene id: 10053
Gene description: adaptor-related protein complex 1, mu 2 subunit
Synonyms: AP1-mu2; HSMU1B; MU-1B; MU1B; mu2; AP-1 complex subunit mu-2; AP-mu chain family member mu1B; HA1 47 kDa subunit 2; adaptor protein complex AP-1 mu-2 subunit; clathrin assembly protein complex 1 mu-2 medium chain 2; clathrin coat assembly protein AP47 2; clathrin coat associated protein AP47 2; clathrin-associated adaptor medium chain mu2; golgi adaptor AP-1 47 kDa protein; golgi adaptor HA1/AP1 adaptin mu-2 subunit; mu-adaptin 2; mu1B-adaptin; adaptor related protein complex 1 mu 2 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgcctcggctgtcttcattctggacgttaagggcaagccattgatcagccgcaactacaagggcgatgtggccatgagcaagattgagcacttcatgcctttgctggtacagcgggaggaggaaggcgccctggccccgctgctgagccacggccaggtccacttcctatggatcaaacacagcaacctctacttggtggccaccacatcgaagaatgccaatgcctccctggtgtactccttcctgtataagacaatagaggtattctgcgaatacttcaaggagctggaggaggagagcatccgggacaactttgtcatcgtctacgagttgctggacgagctcatggactttggcttcccgcagaccaccgacagcaagatcctgcaggagtacatcactcagcagagcaacaagctggagacgggcaagtcacgggtgccacccactgtcaccaacgctgtgtcctggcgctccgagggtatcaagtataagaagaacgaggtcttcattgatgtcatagagtctgtcaacctgctggtcaatgccaacggcagcgtccttctgagcgaaatcgtcggtaccatcaagctcaaggtgtttctgtcgggaatgccagagctgcggctgggcctcaatgaccgcgtgctcttcgagctcactggccgcagcaagaacaaatcagtagagctggaggatgtaaaattccaccagtgcgtgcggctctctcgctttgacaacgaccgcaccatctccttcatcccgcctgatggtgactttgagctcatgtcataccgcctcagcacccaggtcaagccactgatctggattgagtctgtcattgagaagttctcccacagccgcgtggagatcatggtcaaggccaaggggcagtttaagaaacagtcagtggccaacggtgtggagatatctgtgcctgtacccagcgatgccgactcccccagattcaagaccagtgtgggcagcgccaagtatgtgccggagagaaacgtcgtgatttggagtattaagtctttcccggggggcaaggagtacttgatgcgagcccactttggcctccccagtgtggaaaaggaagaggtggagggccggccccccatcggggtcaagtttgagatcccctacttcaccgtctctgggatccaggtccgatacatgaagatcattgagaaaagtggttaccaggccctgccctgggttcgctacatcacccagagtggcgattaccaacttcgtaccagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adaptor-related protein complex 1, mu 2 subunit
- adaptor-related protein complex 2, mu 1 subunit
- transforming growth factor, beta-induced, 68kDa
- acyl-CoA synthetase short-chain family member 3