Login to display prices
Login to display prices
AP2M1-adaptor-related protein complex 2, mu 1 subunit Gene View larger

AP2M1-adaptor-related protein complex 2, mu 1 subunit Gene

PTXBC004996

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AP2M1-adaptor-related protein complex 2, mu 1 subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AP2M1-adaptor-related protein complex 2, mu 1 subunit Gene

Proteogenix catalog: PTXBC004996
Ncbi symbol: AP2M1
Product name: AP2M1-adaptor-related protein complex 2, mu 1 subunit Gene
Size: 2ug
Accessions: BC004996
Gene id: 1173
Gene description: adaptor-related protein complex 2, mu 1 subunit
Synonyms: AP50; CLAPM1; mu2; AP-2 complex subunit mu; AP-2 mu 2 chain; HA2 50 kDA subunit; adaptin-mu2; adaptor protein complex AP-2 subunit mu; adaptor-related protein complex 2 subunit mu; clathrin adaptor complex AP2, mu subunit; clathrin assembly protein complex 2 medium chain; clathrin assembly protein complex 2 mu medium chain; clathrin coat adaptor protein AP50; clathrin coat assembly protein AP50; clathrin coat-associated protein AP50; clathrin-associated/assembly/adaptor protein, medium 1; plasma membrane adaptor AP-2 50 kDa protein; plasma membrane adaptor AP-2 50kDA protein; adaptor related protein complex 2 mu 1 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgttaagcggtccaacatttggctggcagcagtcaccaagcagaatgtcaacgctgccatggtcttcgaattcctctataagatgtgtgacgtgatggctgcctactttggcaagatcagcgaggaaaacatcaagaacaattttgtgctcatatatgagctgctggatgagattctagactttggctacccacagaattccgagacaggcgcgctgaaaaccttcatcacgcagcagggcatcaagagtcagcatcagacaaaagaagagcagtcacagatcaccagccaggtaactgggcagattggctggcggcgagagggtatcaagtatcgtcggaatgagctcttcctggatgtgctggagagtgtgaacctgctcatgtccccacaagggcaggtgctgagtgcccatgtgtcgggccgggtggtgatgaagagctacctgagtggcatgcctgaatgcaagtttgggatgaatgacaagattgttattgaaaagcagggcaaaggcacagctgatgaaacaagcaagagcgggaagcaatcaattgccattgatgactgcaccttccaccagtgtgtgcgactcagcaagtttgactctgaacgcagcatcagctttatcccgccagatggagagtttgagcttatgaggtatcgcacaaccaaggacatcatccttcccttccgggtgatcccgctagtgcgagaagtgggacgcaccaaactggaggtcaaggtggtcatcaagtccaactttaaaccctcactgctggctcagaagatcgaggtgaggatcccaaccccactgaacacaagcggggtgcaggtgatctgcatgaaggggaaggccaagtacaaggccagcgagaatgccatcgtgtggaagatcaagcgcatggcaggcatgaaggaatcgcagatcagcgcagagattgagcttctgcctaccaacgacaagaagaaatgggctcgaccccccatttccatgaactttgaggtgccattcgcgccctctggcctcaaggtgcgctacttgaaggtgtttgaaccgaagctgaactacagcgaccatgatgtcatcaaatgggtgcgctacattggccgcagtggcatttatgaaactcgctgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: