PNPLA3-patatin-like phospholipase domain containing 3 Gene View larger

PNPLA3-patatin-like phospholipase domain containing 3 Gene

PTXBC014449

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PNPLA3-patatin-like phospholipase domain containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PNPLA3-patatin-like phospholipase domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014449
Product type: DNA & cDNA
Ncbi symbol: PNPLA3
Origin species: Human
Product name: PNPLA3-patatin-like phospholipase domain containing 3 Gene
Size: 2ug
Accessions: BC014449
Gene id: 80339
Gene description: patatin-like phospholipase domain containing 3
Synonyms: ADPN; C22orf20; iPLA(2)epsilon; patatin-like phospholipase domain-containing protein 3; acylglycerol O-acyltransferase; adiponutrin; calcium-independent phospholipase A2-epsilon; iPLA2-epsilon; iPLA2epsilon; patatin like phospholipase domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccgacgatgtcctgtggttgcagtgggtgacctcacaggtgttcactcgagtgctgatgtgtctgctccccgcctccaggtcccaaatgccagtgagcagccaacaggcctccccatgcacacctgagcaggactggccctgctggactccctgctcccccgagggctgtccagcagagaccaaagcagaggccaccccgcggtccatcctcaggtccagcctgaacttcttcttgggcaataaagtacctgctggtgctgaggggctctccacctttcccagtttttcactagagaagagtctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 127, member A
- family with sequence similarity 136, member A
- family with sequence similarity 176, member A
- ubiquitin-conjugating enzyme E2A (RAD6 homolog)

Buy PNPLA3-patatin-like phospholipase domain containing 3 Gene now

Add to cart