PTXBC014975
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC014975 |
Product type: | DNA & cDNA |
Ncbi symbol: | FAM136A |
Origin species: | Human |
Product name: | FAM136A-family with sequence similarity 136, member A Gene |
Size: | 2ug |
Accessions: | BC014975 |
Gene id: | 84908 |
Gene description: | family with sequence similarity 136, member A |
Synonyms: | protein FAM136A; family with sequence similarity 136 member A |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atggctgagctgcagcagctccgggtgcaggaggcggtggagtccatggtgaagagtctggaaagagagaacatccggaagatgcagggtctcatgttccggtgcagcgccagctgttgtgaggacagccaggcctccatgaagcaggtgcaccagtgcatcgagcgctgccatgtgcctctggctcaagcccaggctttggtcaccagtgagctggagaagttccaggaccgcctggcccggtgcaccatgcattgcaacgacaaagccaaagattcaatagatgctgggagtaaggagcttcaggtgaagcagcagctggacagttgtgtgaccaagtgtgtggatgaccacatgcacctcatcccaactatgaccaagaagatgaaggaggctctcttatcaattggaaaataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - family with sequence similarity 176, member A - ubiquitin-conjugating enzyme E2A (RAD6 homolog) - growth arrest and DNA-damage-inducible, alpha - myosin, light chain 2, regulatory, cardiac, slow |