Login to display prices
Login to display prices
FAM136A-family with sequence similarity 136, member A Gene View larger

FAM136A-family with sequence similarity 136, member A Gene

PTXBC014975

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM136A-family with sequence similarity 136, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM136A-family with sequence similarity 136, member A Gene

Proteogenix catalog: PTXBC014975
Ncbi symbol: FAM136A
Product name: FAM136A-family with sequence similarity 136, member A Gene
Size: 2ug
Accessions: BC014975
Gene id: 84908
Gene description: family with sequence similarity 136, member A
Synonyms: protein FAM136A; family with sequence similarity 136 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgagctgcagcagctccgggtgcaggaggcggtggagtccatggtgaagagtctggaaagagagaacatccggaagatgcagggtctcatgttccggtgcagcgccagctgttgtgaggacagccaggcctccatgaagcaggtgcaccagtgcatcgagcgctgccatgtgcctctggctcaagcccaggctttggtcaccagtgagctggagaagttccaggaccgcctggcccggtgcaccatgcattgcaacgacaaagccaaagattcaatagatgctgggagtaaggagcttcaggtgaagcagcagctggacagttgtgtgaccaagtgtgtggatgaccacatgcacctcatcccaactatgaccaagaagatgaaggaggctctcttatcaattggaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: